ID: 944207809

View in Genome Browser
Species Human (GRCh38)
Location 2:197175222-197175244
Sequence TGGGACTTCCTGAGAAAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944207805_944207809 19 Left 944207805 2:197175180-197175202 CCTGTGACTGGAGGTCCTATTTC No data
Right 944207809 2:197175222-197175244 TGGGACTTCCTGAGAAAAGCCGG No data
944207806_944207809 4 Left 944207806 2:197175195-197175217 CCTATTTCTTTAAGTGTTCTTAC No data
Right 944207809 2:197175222-197175244 TGGGACTTCCTGAGAAAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944207809 Original CRISPR TGGGACTTCCTGAGAAAAGC CGG Intronic
No off target data available for this crispr