ID: 944210132

View in Genome Browser
Species Human (GRCh38)
Location 2:197198416-197198438
Sequence TAGTCTGCACAAAGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944210127_944210132 26 Left 944210127 2:197198367-197198389 CCTGGAGGAAAAGGCTGGAGTGT No data
Right 944210132 2:197198416-197198438 TAGTCTGCACAAAGGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944210132 Original CRISPR TAGTCTGCACAAAGGGCTCT GGG Intronic
No off target data available for this crispr