ID: 944219480

View in Genome Browser
Species Human (GRCh38)
Location 2:197288084-197288106
Sequence TTGGGCAAACCCTAAATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944219480_944219481 -6 Left 944219480 2:197288084-197288106 CCAAAAATTTAGGGTTTGCCCAA No data
Right 944219481 2:197288101-197288123 GCCCAAAAATCAGTTATAAAAGG No data
944219480_944219486 4 Left 944219480 2:197288084-197288106 CCAAAAATTTAGGGTTTGCCCAA No data
Right 944219486 2:197288111-197288133 CAGTTATAAAAGGAGGATCTGGG No data
944219480_944219485 3 Left 944219480 2:197288084-197288106 CCAAAAATTTAGGGTTTGCCCAA No data
Right 944219485 2:197288110-197288132 TCAGTTATAAAAGGAGGATCTGG No data
944219480_944219484 -3 Left 944219480 2:197288084-197288106 CCAAAAATTTAGGGTTTGCCCAA No data
Right 944219484 2:197288104-197288126 CAAAAATCAGTTATAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944219480 Original CRISPR TTGGGCAAACCCTAAATTTT TGG (reversed) Intronic
No off target data available for this crispr