ID: 944219801

View in Genome Browser
Species Human (GRCh38)
Location 2:197291576-197291598
Sequence TTTCTCATGCAGAATTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944219801_944219804 2 Left 944219801 2:197291576-197291598 CCAGCCAAATTCTGCATGAGAAA No data
Right 944219804 2:197291601-197291623 GGAATAGAAGTATAAGCTCAAGG No data
944219801_944219805 11 Left 944219801 2:197291576-197291598 CCAGCCAAATTCTGCATGAGAAA No data
Right 944219805 2:197291610-197291632 GTATAAGCTCAAGGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944219801 Original CRISPR TTTCTCATGCAGAATTTGGC TGG (reversed) Intronic
No off target data available for this crispr