ID: 944233441

View in Genome Browser
Species Human (GRCh38)
Location 2:197419014-197419036
Sequence GGATTTTAACAGCTTGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944233441 Original CRISPR GGATTTTAACAGCTTGCAAC AGG (reversed) Intronic
900727482 1:4226559-4226581 GGATTTTAACAACCTGCACCAGG + Intergenic
902079133 1:13809201-13809223 GGGTTTTGACAGGTTGCAGCAGG + Intronic
903754535 1:25651701-25651723 GGATTATAACACCTTTGAACAGG - Intronic
905022278 1:34826056-34826078 GGATATTAATAGCTGGCAAAGGG - Intronic
905071607 1:35230668-35230690 GGATTTTAACAGAATGAAAAGGG + Intergenic
908056878 1:60297344-60297366 GGATTTTTACAGCTTCCATTGGG - Intergenic
908849432 1:68360163-68360185 GGATTTTAACGAGTTGCCACGGG - Intergenic
909343844 1:74562175-74562197 GGATTTTTAAAGCTTCCCACAGG + Intergenic
911051850 1:93678092-93678114 GGATTTTAAAAGCTTCCCAGAGG - Intronic
911430702 1:97783027-97783049 GGATTATAACAGCTAGCATTTGG - Intronic
914783723 1:150809297-150809319 GGATTTTAAGAGCTGCTAACAGG + Intergenic
918386972 1:184018849-184018871 GCATTTTTACTGCTTGCTACTGG - Intronic
919516881 1:198536225-198536247 GGGTTTTAAAAGTTTGCAATGGG + Intronic
921218355 1:212955584-212955606 GTTTCTTAACAGCTTGGAACTGG + Intronic
1063851456 10:10196935-10196957 GGGTTTTGACAGCTACCAACAGG - Intergenic
1068374731 10:56164272-56164294 AAATTTCAACAGCATGCAACAGG + Intergenic
1071270215 10:84000184-84000206 GCAGTTTAACAGCTTAAAACTGG - Intergenic
1077892278 11:6427915-6427937 GGAATTTAACAGCATGAAAAGGG + Intergenic
1078372961 11:10766108-10766130 TTATTTTAAAAGCTTGGAACCGG - Intronic
1079557739 11:21781929-21781951 GTGTCTTAACACCTTGCAACGGG - Intergenic
1082202139 11:49384948-49384970 GAATTTTAACACTTTGCATCAGG - Intergenic
1082738973 11:56889456-56889478 AGATTTAAACAGCTTTCAAAGGG + Intergenic
1086653525 11:89321201-89321223 GAATTTTAACACTTTGCATCAGG + Intergenic
1086948412 11:92866962-92866984 GGATGTTATCCGCTTGCACCAGG - Exonic
1087261705 11:96019392-96019414 GGTCTTTAATACCTTGCAACAGG + Intronic
1088865587 11:113844802-113844824 GGATTTTAAGATGGTGCAACTGG + Intronic
1088926332 11:114306981-114307003 GGACTTTCACAGCTTGCAAAAGG + Intronic
1093470100 12:19491980-19492002 TGATTTTAGCAGCTTACAATTGG + Intronic
1094096504 12:26711192-26711214 AGATTTAAGCATCTTGCAACTGG - Exonic
1096223671 12:49849637-49849659 GGATTATAAACGCTGGCAACAGG + Intergenic
1099858454 12:88200683-88200705 GGATTATAAAAGCTTGCCAATGG + Intergenic
1109236994 13:59834691-59834713 GGAGTTTAACAGTTTGCACAAGG - Intronic
1109514675 13:63426972-63426994 GGAATTTTACAGCTGGCAGCTGG + Intergenic
1112701456 13:102013870-102013892 AGAGTCTAACAGCTTGCAAGAGG + Intronic
1115024346 14:28723898-28723920 GGATGTTAATTGCTTGCAATGGG + Intergenic
1118647360 14:67852336-67852358 GGACTATAACAGCTGGCACCAGG + Intronic
1121516944 14:94558691-94558713 AGATTTTAGGAGCTTGCCACTGG + Intergenic
1122017992 14:98813117-98813139 GGATTTTGTCAGCCAGCAACAGG + Intergenic
1125369177 15:38951858-38951880 GGATTCTGACAGCTTGGAAAAGG + Intergenic
1126810379 15:52396856-52396878 GGATTTTAACAGCTAAAGACAGG + Intronic
1129304749 15:74651566-74651588 GGATTCTGACAGCTTGCTGCTGG - Intronic
1130795576 15:87205332-87205354 GGTTTTTATCAACTTTCAACTGG + Intergenic
1131315926 15:91337439-91337461 GGATTTGCACAGCTAGCAAGAGG - Intergenic
1133620940 16:7525789-7525811 GGATTCTAACAGCATTCAAAAGG - Intronic
1137344933 16:47647796-47647818 CCATTTTAACATCTTGAAACTGG + Intronic
1137681968 16:50356178-50356200 GGATTTTCATACCTTGCAATTGG + Intronic
1141253952 16:82383691-82383713 GAAATTGAACAGCTTGCAAAAGG + Intergenic
1148980540 17:51570721-51570743 GGATTTTAAGAGCTTACAGTAGG - Intergenic
1151250405 17:72829675-72829697 GGATTTTAACAGATGGAAAGGGG - Intronic
1155162613 18:23208050-23208072 GGATTGTAACAGGTGGGAACAGG - Intronic
1157896957 18:51478568-51478590 GGATTTTCACTGATTGCACCTGG + Intergenic
1165302754 19:34981842-34981864 AAATTTTAAAAGTTTGCAACTGG - Intergenic
926296883 2:11575429-11575451 GGATTTTAATAGCTTCCAGGAGG + Intronic
927481519 2:23457585-23457607 GGATTGTAACAGCGTCCCACTGG + Intronic
929827468 2:45320265-45320287 GAAATTAAACAGCTTGCACCAGG - Intergenic
930138673 2:47929327-47929349 GCACTTTAACAGTTTGCCACTGG + Intergenic
932509394 2:72270203-72270225 GGGTTTTAGCAGCTGCCAACAGG - Intronic
935658942 2:105448873-105448895 GGATTTTGACAGCTAGAAAATGG + Intergenic
936674439 2:114698776-114698798 GCATTTTCACAGCTTGCATTTGG + Intronic
940009269 2:149037958-149037980 GGAATCTAACAGCTTGCCTCTGG + Intergenic
944223031 2:197321613-197321635 TGATTTTAAAAGCATGCAATTGG + Intergenic
944233441 2:197419014-197419036 GGATTTTAACAGCTTGCAACAGG - Intronic
946565194 2:220956730-220956752 AGGGTTTCACAGCTTGCAACGGG - Intergenic
947399541 2:229717349-229717371 GGATTTTAAAAGTTTCCATCTGG - Intergenic
1169953620 20:11076669-11076691 GGCTTTTACCAGCTAGCAGCTGG + Intergenic
1181506840 22:23364349-23364371 GGTTTCTAACAGCTAGCAATGGG + Intergenic
949304897 3:2628831-2628853 GGATTGTAACAATTTGGAACTGG + Intronic
951221775 3:20076164-20076186 GGGTTTTAAGAGCTTGTGACAGG + Intronic
952298436 3:32082658-32082680 GAATTTTAAAAGCTTGTGACAGG + Intergenic
957984509 3:87556393-87556415 GGATTTGAGTAGCTAGCAACAGG + Intergenic
960179294 3:114555915-114555937 GGACTTAAGCAGCTTGAAACTGG + Intronic
960511150 3:118550898-118550920 GGATTTTAGCAGATGGCAACAGG + Intergenic
961745861 3:129063073-129063095 TGATTTTAACATCTGGCACCAGG - Intergenic
963030487 3:140968883-140968905 GAATTTTAAAAGCTTAAAACTGG - Intronic
965254048 3:166381154-166381176 GGATTTTAACACTTTGCATTAGG - Intergenic
967145249 3:186600963-186600985 GGATTTGCACAGCTGGCAAGAGG - Intergenic
967308500 3:188083559-188083581 GGCTTTTGACAGCTTGGAAGAGG - Intergenic
968011750 3:195285721-195285743 GGAATTTATCAGTTTACAACTGG - Intronic
971232090 4:24808234-24808256 GAATATTCACAGTTTGCAACAGG + Exonic
972915200 4:43868610-43868632 CCATTTTCACAGGTTGCAACTGG - Intergenic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
973801846 4:54486215-54486237 GGATTTGAACTTCTTACAACTGG + Intergenic
976316108 4:83660632-83660654 GCTTTTTAACAACTTGCCACTGG - Intergenic
980620763 4:135299884-135299906 GTAGTTTAACAGCTTGAAATTGG + Intergenic
981087910 4:140702611-140702633 GGATTCTGACAGCTTCAAACTGG + Intronic
983321657 4:166202824-166202846 GGCTTTTACCAGTTTGCAAAGGG - Intergenic
984010315 4:174363171-174363193 GTATTTTAGCAGCTAGCTACAGG - Intergenic
984950355 4:185003388-185003410 GGATTGGAAGAGCTTGCTACTGG - Intergenic
992521876 5:77562037-77562059 GGATTTTCACAACTTACAATAGG - Intronic
993143700 5:84067755-84067777 GGATTTTATGAGGTTTCAACGGG - Intronic
993212165 5:84965709-84965731 GGATCTTAACAGCTTCCTTCTGG - Intergenic
993767424 5:91878552-91878574 GGAATTTAAGTGCTTGCACCAGG + Intergenic
995529808 5:113081404-113081426 GGTGTTTAACAGCTTACAAAGGG - Intronic
1003360480 6:5420761-5420783 GGAAGTCAACAGCTTGCACCAGG - Intronic
1007285199 6:40742614-40742636 TGATTTTATAAGCTTGCAAAGGG + Intergenic
1013965964 6:115955548-115955570 TGTTTTTAACAGCATTCAACAGG + Intronic
1015199413 6:130562299-130562321 GGAATGTAACAGCTTGAAAAGGG + Intergenic
1016394945 6:143613890-143613912 TGAGTTTAACAGCATTCAACAGG + Intronic
1021599109 7:22346311-22346333 GCATTTTAATAGATTGAAACAGG + Intronic
1036743511 8:11388328-11388350 GGATTTTAAAAGTTGGCAAAAGG - Intergenic
1041985250 8:63915172-63915194 GGATTTTAATTTCTGGCAACAGG + Intergenic
1045606035 8:103777691-103777713 ATATTTTAACAGCTTTCAAATGG - Intronic
1046328969 8:112688874-112688896 GCATTTTAACAGATTCCAAAAGG - Intronic
1046427540 8:114074479-114074501 GGAATGTAACAACTTGCGACAGG - Intergenic
1047415045 8:124657789-124657811 GTAATTTAACAGCTTGAAATGGG - Intronic
1048063646 8:130946435-130946457 AGATTTTAACAGGTAGCAAAAGG - Intronic
1048287973 8:133157115-133157137 GGATTTTAACAGGATGCTTCTGG + Intergenic
1048788162 8:138074156-138074178 AGATTTTAAAAGCTTGAAAGGGG - Intergenic
1050105961 9:2167181-2167203 GGATTTAATTAGTTTGCAACTGG + Intronic
1052059219 9:23940655-23940677 GAATTTCAACAGCATGCTACAGG - Intergenic
1055679635 9:78702274-78702296 GGATTTTAACAGCATCCAAAAGG - Intergenic
1056296409 9:85197786-85197808 AGATTTTAACAGCTGGGAAAAGG - Intergenic
1056850372 9:90078994-90079016 AGATTGTAACAGCTTGAACCTGG + Intergenic
1057322531 9:94028193-94028215 TGATTTTCACATCTTACAACTGG - Intergenic
1059896097 9:118867488-118867510 GAATTTGACCAGCTTGCAATAGG - Intergenic
1061384015 9:130277431-130277453 GGTGGTTGACAGCTTGCAACTGG + Intergenic
1185751918 X:2618195-2618217 GGATTTGAAAAGCTTAGAACTGG + Intergenic
1189095971 X:38140109-38140131 GGATTTTAAAAGCTTCCAAGGGG - Intronic
1193560352 X:83010207-83010229 GGATTTTAAGAACTTTCCACTGG + Intergenic
1194670456 X:96726185-96726207 AGCTTTTATCATCTTGCAACTGG + Intronic
1196850329 X:119931674-119931696 GGATTTTAACAGGAAGAAACTGG + Intronic
1200738322 Y:6825706-6825728 GGATTTTAACATTTTTCTACTGG + Intergenic
1201551124 Y:15217706-15217728 GGATTTTGTCAGCTTTCCACTGG - Intergenic
1201857667 Y:18563316-18563338 TTATTTTAACTGCTTGCAATGGG - Intronic
1201875654 Y:18757065-18757087 TTATTTTAACTGCTTGCAATGGG + Intronic