ID: 944238635

View in Genome Browser
Species Human (GRCh38)
Location 2:197464293-197464315
Sequence AACTCAGTTTTAAAAATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944238635_944238636 -7 Left 944238635 2:197464293-197464315 CCAAAGATTTTTAAAACTGAGTT No data
Right 944238636 2:197464309-197464331 CTGAGTTATTTTTTGCCCACAGG No data
944238635_944238639 18 Left 944238635 2:197464293-197464315 CCAAAGATTTTTAAAACTGAGTT No data
Right 944238639 2:197464334-197464356 TTAATGATGATATAATTTCTTGG No data
944238635_944238640 25 Left 944238635 2:197464293-197464315 CCAAAGATTTTTAAAACTGAGTT No data
Right 944238640 2:197464341-197464363 TGATATAATTTCTTGGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944238635 Original CRISPR AACTCAGTTTTAAAAATCTT TGG (reversed) Intronic
No off target data available for this crispr