ID: 944238636

View in Genome Browser
Species Human (GRCh38)
Location 2:197464309-197464331
Sequence CTGAGTTATTTTTTGCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944238633_944238636 8 Left 944238633 2:197464278-197464300 CCCATTTTGGAGTGGCCAAAGAT No data
Right 944238636 2:197464309-197464331 CTGAGTTATTTTTTGCCCACAGG No data
944238635_944238636 -7 Left 944238635 2:197464293-197464315 CCAAAGATTTTTAAAACTGAGTT No data
Right 944238636 2:197464309-197464331 CTGAGTTATTTTTTGCCCACAGG No data
944238634_944238636 7 Left 944238634 2:197464279-197464301 CCATTTTGGAGTGGCCAAAGATT No data
Right 944238636 2:197464309-197464331 CTGAGTTATTTTTTGCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944238636 Original CRISPR CTGAGTTATTTTTTGCCCAC AGG Intronic
No off target data available for this crispr