ID: 944238639

View in Genome Browser
Species Human (GRCh38)
Location 2:197464334-197464356
Sequence TTAATGATGATATAATTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944238635_944238639 18 Left 944238635 2:197464293-197464315 CCAAAGATTTTTAAAACTGAGTT No data
Right 944238639 2:197464334-197464356 TTAATGATGATATAATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944238639 Original CRISPR TTAATGATGATATAATTTCT TGG Intronic
No off target data available for this crispr