ID: 944238640

View in Genome Browser
Species Human (GRCh38)
Location 2:197464341-197464363
Sequence TGATATAATTTCTTGGTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944238635_944238640 25 Left 944238635 2:197464293-197464315 CCAAAGATTTTTAAAACTGAGTT No data
Right 944238640 2:197464341-197464363 TGATATAATTTCTTGGTAAGTGG No data
944238638_944238640 -7 Left 944238638 2:197464325-197464347 CCACAGGATTTAATGATGATATA No data
Right 944238640 2:197464341-197464363 TGATATAATTTCTTGGTAAGTGG No data
944238637_944238640 -6 Left 944238637 2:197464324-197464346 CCCACAGGATTTAATGATGATAT No data
Right 944238640 2:197464341-197464363 TGATATAATTTCTTGGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944238640 Original CRISPR TGATATAATTTCTTGGTAAG TGG Intronic
No off target data available for this crispr