ID: 944245836

View in Genome Browser
Species Human (GRCh38)
Location 2:197529824-197529846
Sequence CTGTATATTTAGTACAGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944245826_944245836 28 Left 944245826 2:197529773-197529795 CCTCCCGAGTAGCTGGGACTACA 0: 54131
1: 174214
2: 265888
3: 193370
4: 113909
Right 944245836 2:197529824-197529846 CTGTATATTTAGTACAGACGGGG No data
944245830_944245836 -3 Left 944245830 2:197529804-197529826 CCACCGTGCCCAGCTAATTTCTG No data
Right 944245836 2:197529824-197529846 CTGTATATTTAGTACAGACGGGG No data
944245831_944245836 -6 Left 944245831 2:197529807-197529829 CCGTGCCCAGCTAATTTCTGTAT 0: 317
1: 22978
2: 53230
3: 95405
4: 109765
Right 944245836 2:197529824-197529846 CTGTATATTTAGTACAGACGGGG No data
944245828_944245836 25 Left 944245828 2:197529776-197529798 CCCGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 944245836 2:197529824-197529846 CTGTATATTTAGTACAGACGGGG No data
944245829_944245836 24 Left 944245829 2:197529777-197529799 CCGAGTAGCTGGGACTACAGGCG 0: 42478
1: 106370
2: 174364
3: 132619
4: 206690
Right 944245836 2:197529824-197529846 CTGTATATTTAGTACAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944245836 Original CRISPR CTGTATATTTAGTACAGACG GGG Intronic
No off target data available for this crispr