ID: 944250988

View in Genome Browser
Species Human (GRCh38)
Location 2:197580052-197580074
Sequence TTGCCAAGTGGGCCATGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944250988_944250993 13 Left 944250988 2:197580052-197580074 CCAGTTCATGGCCCACTTGGCAA No data
Right 944250993 2:197580088-197580110 CTTTACCGCCCTAGACCCAGAGG 0: 27
1: 39
2: 32
3: 16
4: 51
944250988_944250996 16 Left 944250988 2:197580052-197580074 CCAGTTCATGGCCCACTTGGCAA No data
Right 944250996 2:197580091-197580113 TACCGCCCTAGACCCAGAGGGGG No data
944250988_944250994 14 Left 944250988 2:197580052-197580074 CCAGTTCATGGCCCACTTGGCAA No data
Right 944250994 2:197580089-197580111 TTTACCGCCCTAGACCCAGAGGG 0: 33
1: 60
2: 51
3: 36
4: 67
944250988_944250995 15 Left 944250988 2:197580052-197580074 CCAGTTCATGGCCCACTTGGCAA No data
Right 944250995 2:197580090-197580112 TTACCGCCCTAGACCCAGAGGGG 0: 26
1: 52
2: 48
3: 104
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944250988 Original CRISPR TTGCCAAGTGGGCCATGAAC TGG (reversed) Intronic
No off target data available for this crispr