ID: 944250988

View in Genome Browser
Species Human (GRCh38)
Location 2:197580052-197580074
Sequence TTGCCAAGTGGGCCATGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944250988_944250994 14 Left 944250988 2:197580052-197580074 CCAGTTCATGGCCCACTTGGCAA No data
Right 944250994 2:197580089-197580111 TTTACCGCCCTAGACCCAGAGGG No data
944250988_944250995 15 Left 944250988 2:197580052-197580074 CCAGTTCATGGCCCACTTGGCAA No data
Right 944250995 2:197580090-197580112 TTACCGCCCTAGACCCAGAGGGG No data
944250988_944250996 16 Left 944250988 2:197580052-197580074 CCAGTTCATGGCCCACTTGGCAA No data
Right 944250996 2:197580091-197580113 TACCGCCCTAGACCCAGAGGGGG No data
944250988_944250993 13 Left 944250988 2:197580052-197580074 CCAGTTCATGGCCCACTTGGCAA No data
Right 944250993 2:197580088-197580110 CTTTACCGCCCTAGACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944250988 Original CRISPR TTGCCAAGTGGGCCATGAAC TGG (reversed) Intronic