ID: 944250993

View in Genome Browser
Species Human (GRCh38)
Location 2:197580088-197580110
Sequence CTTTACCGCCCTAGACCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 27, 1: 39, 2: 32, 3: 16, 4: 51}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944250984_944250993 19 Left 944250984 2:197580046-197580068 CCCAGCCCAGTTCATGGCCCACT 0: 8
1: 56
2: 157
3: 266
4: 417
Right 944250993 2:197580088-197580110 CTTTACCGCCCTAGACCCAGAGG 0: 27
1: 39
2: 32
3: 16
4: 51
944250987_944250993 14 Left 944250987 2:197580051-197580073 CCCAGTTCATGGCCCACTTGGCA No data
Right 944250993 2:197580088-197580110 CTTTACCGCCCTAGACCCAGAGG 0: 27
1: 39
2: 32
3: 16
4: 51
944250988_944250993 13 Left 944250988 2:197580052-197580074 CCAGTTCATGGCCCACTTGGCAA No data
Right 944250993 2:197580088-197580110 CTTTACCGCCCTAGACCCAGAGG 0: 27
1: 39
2: 32
3: 16
4: 51
944250990_944250993 1 Left 944250990 2:197580064-197580086 CCACTTGGCAACAACCCTTAGAT No data
Right 944250993 2:197580088-197580110 CTTTACCGCCCTAGACCCAGAGG 0: 27
1: 39
2: 32
3: 16
4: 51
944250985_944250993 18 Left 944250985 2:197580047-197580069 CCAGCCCAGTTCATGGCCCACTT 0: 8
1: 55
2: 152
3: 264
4: 435
Right 944250993 2:197580088-197580110 CTTTACCGCCCTAGACCCAGAGG 0: 27
1: 39
2: 32
3: 16
4: 51
944250989_944250993 2 Left 944250989 2:197580063-197580085 CCCACTTGGCAACAACCCTTAGA No data
Right 944250993 2:197580088-197580110 CTTTACCGCCCTAGACCCAGAGG 0: 27
1: 39
2: 32
3: 16
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944250993 Original CRISPR CTTTACCGCCCTAGACCCAG AGG Intronic
902050879 1:13562843-13562865 CTTTACCGCCCTAGACCCAGAGG + Intergenic
902970456 1:20044473-20044495 CTTTACAGCCTTGGACCCAGAGG - Intronic
903396064 1:23002710-23002732 CCTTACTGCCCTAGACACAGAGG - Intergenic
903602141 1:24550284-24550306 CTTTACAGCCATAGAGCTAGAGG - Intergenic
903828766 1:26162482-26162504 CTTGACCTCCCTGGACGCAGCGG + Exonic
904393922 1:30205367-30205389 CTTTACCGCCCTAGACCCAGAGG + Intergenic
905429247 1:37909628-37909650 CTTTACCGCCCTAGACCCAGAGG + Intronic
906378688 1:45317583-45317605 CTTTACTGCCCTAGACCCCAAGG + Intergenic
907293561 1:53434199-53434221 CTTTACTGCCCTAGACACAGAGG + Intergenic
909729393 1:78874219-78874241 CTTTACTGCCCTAGATCCAGAGG + Intergenic
916941754 1:169684815-169684837 TTTTACAGCCTTGGACCCAGAGG + Intronic
917360821 1:174173919-174173941 CTTTACCTATCTAGACTCAGTGG + Intronic
920427375 1:205889005-205889027 CTTTACTGCCCTAGACCCAGAGG - Intergenic
920907974 1:210189257-210189279 CTTTACCACCCTAGACCCAGAGG + Intergenic
922368459 1:224887392-224887414 CTTTACAGCCCTAGACCCAGAGG + Intergenic
922598938 1:226835215-226835237 TTTTACTGCCCTAGACCCAGAGG + Intergenic
922845453 1:228680703-228680725 CTTTACCGCCCTAGACCCAGAGG - Intergenic
1063106450 10:2996751-2996773 TTTTACCTCCTTAGACCCATAGG - Intergenic
1065443177 10:25772594-25772616 CTATACCGCCCTAGACCCAGAGG - Intergenic
1066437398 10:35406988-35407010 CTTTACCACCCTAGACCCAGAGG - Intronic
1071187197 10:83059097-83059119 CCTTACAGCCCTAGACCCAGAGG + Intergenic
1073013977 10:100383704-100383726 CTTTACCGCCCTAGACCCAGAGG + Intergenic
1076264519 10:129099285-129099307 CTTGACTACCCTAGGCCCAGAGG + Intergenic
1077338236 11:2014833-2014855 CTTCTCTGCCCTAGGCCCAGGGG + Intergenic
1081159670 11:39736337-39736359 CTTTACTGCCCTAGACCCAGAGG + Intergenic
1082197794 11:49325168-49325190 CTTTACTGCCCTAGTCCCAGAGG - Intergenic
1083300830 11:61738899-61738921 CTTTGGTGCCCTAGACCCTGTGG + Intronic
1085570154 11:77551880-77551902 CTTTACCACCCTAGATCCAGAGG + Intronic
1086658024 11:89382958-89382980 CTTTACCGCCCTAGACCCAGAGG + Intronic
1087201784 11:95352886-95352908 CTTTACTACCCTACACCCTGAGG + Intergenic
1089540621 11:119187374-119187396 CTGTCCCACCCTAGGCCCAGGGG + Exonic
1202821220 11_KI270721v1_random:70015-70037 CTTCTCTGCCCTAGGCCCAGGGG + Intergenic
1093024289 12:14232527-14232549 CTTTACCACCCTAGACCCACAGG + Intergenic
1093302198 12:17471524-17471546 CTTTACTGCCGTAGGGCCAGAGG + Intergenic
1096220489 12:49825909-49825931 CTTTCCAGCCCAAGAGCCAGAGG - Intronic
1098919870 12:76293408-76293430 CTTTACTGCCCTAGACCCAGAGG + Intergenic
1102604430 12:114057791-114057813 CTTTACCGCCCTAGACCCAGAGG + Intergenic
1106651769 13:31698587-31698609 CTTCAACTCCCTAGACCCAGAGG - Intergenic
1112716895 13:102197334-102197356 TACTACTGCCCTAGACCCAGGGG + Intronic
1113961547 13:114128900-114128922 CTTTCCCGCCCTGGACCGCGGGG + Intronic
1117174124 14:53130412-53130434 TTTTACCACCCTAGACCCAGAGG + Intronic
1119560325 14:75584434-75584456 CTTTACCGCCCTAGACCCAGAGG - Intronic
1121289380 14:92761812-92761834 CTTTACAGCCCTAGACCCAGAGG + Intergenic
1122507592 14:102241577-102241599 CTTTACCGCCCTAGACCCAGAGG + Intronic
1124074167 15:26427058-26427080 CTTTACCACCCCATACCCACAGG + Intergenic
1125629182 15:41133460-41133482 CTTTACAGCCTTGGACCCAGAGG + Intergenic
1127706190 15:61549394-61549416 CTTCACGGCCCAAGACTCAGAGG + Intergenic
1131038524 15:89241881-89241903 ATGTACAGCCCTAGACCCAAAGG + Intergenic
1133869586 16:9674878-9674900 CTATACCACCCTAGACCCAGAGG - Intronic
1141301211 16:82817245-82817267 CTATCCAGCCCTACACCCAGTGG + Intronic
1142550076 17:732831-732853 CTTTTCCGCCCTGGGCCCCGCGG - Intronic
1145080707 17:19892194-19892216 CTTTACCACCCTAGACCCAGAGG - Intergenic
1145249254 17:21288378-21288400 GTTTACCACCCTTGGCCCAGGGG + Intronic
1149319480 17:55469431-55469453 CTTTACCACCCTAGACCCAGAGG + Intergenic
1152453915 17:80401858-80401880 CTTTACCGCCCTAGACCCAGAGG + Intergenic
1155961958 18:32002556-32002578 CTTTACCACCCTAGACCCAGAGG + Intergenic
1158576735 18:58644715-58644737 CCTTACTGCCCTAGACCCAGAGG - Intergenic
1161712004 19:5854059-5854081 CTTTACCACCCTAGACCCAGAGG + Intergenic
1161772061 19:6236303-6236325 CTTCACAGCCCCAAACCCAGGGG + Intronic
1162274214 19:9640143-9640165 CTTTACAGCCCTAGACCCATGGG - Intronic
1162286633 19:9743778-9743800 CTTTACAGCACTAGACCAAGAGG + Intergenic
1163900262 19:20094386-20094408 CTTTACCGCCCTAGACCCAGAGG - Intronic
1164080762 19:21859734-21859756 CTTTACCCCCCTAGACCCAGAGG + Intergenic
1166905834 19:46107812-46107834 CTTTACTGCCCTAGACCCAGAGG - Intergenic
928341354 2:30445949-30445971 CCTTACCGCCCTAACCACAGAGG - Intergenic
931710859 2:64988732-64988754 CTTTACCGCACAAGCCCCTGAGG + Intronic
933861160 2:86469682-86469704 CTCTAACTCCATAGACCCAGGGG + Intronic
938863818 2:135397809-135397831 TTTTACAGCCCTAGATCAAGAGG + Intronic
940183644 2:150960264-150960286 CTTTACTGCCCTAGACCCAGAGG + Intergenic
940216777 2:151310783-151310805 TTTTACTGCCCTAGACCCATAGG + Intergenic
940726479 2:157341867-157341889 CTTTACCGCTCTAGACCCAGAGG - Intergenic
944250993 2:197580088-197580110 CTTTACCGCCCTAGACCCAGAGG + Intronic
945858081 2:215091538-215091560 CTTTACTGCCCTAGACCCAGAGG + Intronic
947845036 2:233237031-233237053 CTTGACTGCTCCAGACCCAGAGG + Intronic
1168839223 20:898495-898517 CTTCACAGCCCTAGACCCAGAGG + Intronic
1168917852 20:1505929-1505951 CTCTGCAGCCCTAGACCTAGGGG + Intergenic
1172895330 20:38296040-38296062 CTTTACAGCCCTGGACCCTGAGG + Intronic
1172932510 20:38596493-38596515 CTTTACCGCCCTAGACCCAGAGG - Intergenic
1173651989 20:44672312-44672334 CTTTACCGCCCTAGACCCAGAGG + Intergenic
1173781687 20:45761742-45761764 CTTTACCGCCCTAGACCCAGAGG + Intronic
1173792954 20:45840189-45840211 CTTTTCCAAACTAGACCCAGAGG - Intronic
1176144830 20:63560953-63560975 CCTGACACCCCTAGACCCAGAGG + Intronic
1177063055 21:16397095-16397117 CTTTACCGCCCTAGACCCAGAGG - Intergenic
1180256578 21:46634063-46634085 CTCTACCACCCTAGAAGCAGAGG + Intergenic
1180560911 22:16613584-16613606 CTATACTGCCCTAGACCCAGAGG + Intergenic
1183547259 22:38461104-38461126 CTTTATCGCCCCAGCCCCTGGGG - Intergenic
1183635710 22:39061248-39061270 CTTTACCGCCCTAGACCCAGAGG - Intronic
1185276881 22:49953708-49953730 CTCTCCCAGCCTAGACCCAGGGG + Intergenic
952296833 3:32069549-32069571 CTTTACCGCCCTAGACCCAGAGG + Intronic
952895249 3:38074426-38074448 CTTTACCGCCCTAGACCCAGAGG - Intronic
953599480 3:44348756-44348778 CTTTACTGCCCTAGACCCAGAGG - Intronic
953841204 3:46391497-46391519 CTTTACCTCTCTAGACCCAGAGG - Intergenic
957394326 3:79619764-79619786 CTTTACCACCCTAGACCCAGAGG + Intronic
958755492 3:98245934-98245956 TTTTACAGCCCTAGACCCAGAGG + Intergenic
961379688 3:126488825-126488847 CTTTACCGCTGTCTACCCAGGGG - Intronic
961712759 3:128839950-128839972 CTTTACCGCCCTAGACCCAGAGG - Intergenic
963319701 3:143799233-143799255 CTTTACTGCCCTAGACCCATAGG + Intronic
963968570 3:151402560-151402582 CCTTCCCGCCCTAGGGCCAGTGG - Intronic
964067831 3:152599316-152599338 CTTTACTGCCCTAGACCCAGAGG + Intergenic
964176083 3:153827035-153827057 CTTTACTGCCCTAGACCCAGAGG - Intergenic
967996517 3:195170966-195170988 GTTTACCTCCCTGGACACAGAGG - Intronic
968237079 3:197039064-197039086 CTTTGCCACCCTAGACCTACAGG - Intergenic
968237174 3:197039942-197039964 CTGTACGGTCCTAGACCCAACGG - Intergenic
968278077 3:197456152-197456174 CTTCAATCCCCTAGACCCAGAGG + Intergenic
973751081 4:54021754-54021776 TTTTACTGCCCTAGACCCACAGG + Intronic
978303267 4:107294180-107294202 CTTTACCGCCCTAGACTCAGAGG - Intergenic
980714376 4:136612233-136612255 CTTTACAGCCCTAGACTCAGAGG + Intergenic
981482767 4:145255283-145255305 CTTTACCACCCTAGACCCAGAGG - Intergenic
982226017 4:153167161-153167183 CTTTACCTCCCTGGACACTGTGG - Intronic
982318770 4:154058227-154058249 CTTTACTGCCCTAGCCCCAGAGG + Intergenic
984411679 4:179405165-179405187 CTTTACCACCCTAGACCCAGAGG + Intergenic
988199050 5:28047586-28047608 CTTTACCACCCTAGACCCAGAGG + Intergenic
989659884 5:43788089-43788111 CTTTACCGCCCTAGACCCAGAGG + Intergenic
989688940 5:44118473-44118495 CTTTACCACCCTAGACCCAGAGG - Intergenic
992452047 5:76884150-76884172 CTTTACTGCCCTAGACCCAGAGG - Intronic
994324833 5:98436514-98436536 CTTTACCGCCCTAGACCCAGAGG + Intergenic
994375827 5:99015066-99015088 CTTTATGGTCCTAGACCCAGAGG - Intergenic
994778990 5:104067926-104067948 CTTTACCACCCTAGACACAGAGG - Intergenic
995125203 5:108572208-108572230 CTTTACCACCCTAGACACAGAGG - Intergenic
997157250 5:131573814-131573836 CTTTACAGCCCTAGACCCAGAGG + Intronic
997770668 5:136550086-136550108 CTTTACCGCCCTAGACCCAGAGG - Intergenic
1001354514 5:171006780-171006802 CTTTACCACCCTAGACCCAGAGG - Intronic
1004220784 6:13744348-13744370 CTTAAACAACCTAGACCCAGTGG - Intergenic
1005786622 6:29250970-29250992 CTTTACCGCCCTAGACCCAGAGG - Intergenic
1013808131 6:114016077-114016099 CTTTACCACCCTAGACCCAGAGG - Intergenic
1014396023 6:120927162-120927184 CTTTACCACCCTAGACCCAGAGG + Intergenic
1017269770 6:152492159-152492181 CTTTGCCGCCCTAGACCCAGAGG + Intronic
1017922879 6:158886794-158886816 CTTTACCGCCCTAGACCCACAGG - Intronic
1019268050 7:129863-129885 CTCTACCACCCTATTCCCAGTGG - Intergenic
1019619221 7:1981517-1981539 ATTTACCTCCCTAAACCCATCGG - Intronic
1020794168 7:12661539-12661561 CTCTACCACCCTAGACCCATAGG + Intergenic
1021197601 7:17690388-17690410 CTCTCCCGCCCTGAACCCAGAGG - Intergenic
1021660581 7:22915091-22915113 CTTTACCACCCCAGACCCAGAGG + Intergenic
1024739292 7:52337383-52337405 CTTTACTGCCCTAGACCCAGAGG - Intergenic
1029317118 7:99725215-99725237 CTTCACAGCCCTGGACCCAGAGG + Intronic
1030163654 7:106532165-106532187 CTTTACTGCCCTAGACCCAGAGG - Intergenic
1033625545 7:143106796-143106818 CTTTACCACCCTAGACACAGAGG + Intergenic
1035123568 7:156590571-156590593 TTTTACCTCCCCAGACCCTGGGG - Intergenic
1039499038 8:38002441-38002463 CTTGACTGCCCTAGACCCAGAGG - Intergenic
1043720809 8:83545356-83545378 CTTTATCACCCTAGATCTAGAGG + Intergenic
1046074863 8:109302786-109302808 CTTTACCGCCCTAGACCCAGAGG + Intronic
1048652168 8:136490185-136490207 CATTCCCCCCCTATACCCAGAGG - Intergenic
1050140436 9:2511380-2511402 CTTTACCACCCTAGACCCATAGG + Intergenic
1053059963 9:35023042-35023064 CTTTACCGCCCTAGACCCAGAGG - Intergenic
1053078502 9:35154970-35154992 CTTTATTGCCCTAGACCCAGAGG - Intergenic
1053134171 9:35638981-35639003 CTTTACCGCCCTAGACCCAGAGG + Intronic
1056363663 9:85882637-85882659 TTTTACCACCCTAGACCCATAGG + Intergenic
1060226157 9:121792269-121792291 CTATACCGCCCTAGACCCAGAGG + Intergenic
1062100559 9:134726133-134726155 CTCACCCGCCCTAGACCCCGAGG - Intronic
1062691531 9:137844687-137844709 CTTTACCACCCTAGACCCAGAGG + Intronic
1187103809 X:16220557-16220579 CTTTACTGCCTTAGACCCAGAGG - Intergenic
1188891052 X:35611400-35611422 CTTTACCATTCTAGACCCACAGG + Intergenic
1189725504 X:43964592-43964614 CTTTTCCTCCCTAGACCCATTGG + Intronic
1191014239 X:55792042-55792064 TTTTACCACCCTAGACCCAGAGG - Intergenic
1192454553 X:71266154-71266176 GTTTACCACCCTAGACCCAGAGG + Intergenic
1192764636 X:74128575-74128597 CTTTACAGCCTTAGACCCAGAGG - Intergenic
1192914176 X:75636024-75636046 CTTTACCACCCTAGACCCAGAGG - Intergenic
1193414234 X:81202229-81202251 CCTTACCGCTGTAGAGCCAGAGG - Exonic
1193537057 X:82728833-82728855 CTTTATCACCCTAGACCCAGAGG + Intergenic
1196585081 X:117419611-117419633 TTTTACCACCCTAGACCCATAGG + Intergenic
1200007872 X:153099774-153099796 CTTTACCACCCTAGACCCAGAGG - Intergenic
1200812808 Y:7502679-7502701 CTTTACCACCCTAGAGCCAGAGG + Intergenic
1200885011 Y:8258959-8258981 CTTGACCTACCTGGACCCAGTGG - Intergenic
1201061703 Y:10052056-10052078 CTTTACTGTCCTAAACCCAGAGG - Intergenic
1202062053 Y:20898519-20898541 CTTTACCACGCTAGACCCAGAGG + Intergenic