ID: 944250994

View in Genome Browser
Species Human (GRCh38)
Location 2:197580089-197580111
Sequence TTTACCGCCCTAGACCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 33, 1: 60, 2: 51, 3: 36, 4: 67}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944250987_944250994 15 Left 944250987 2:197580051-197580073 CCCAGTTCATGGCCCACTTGGCA No data
Right 944250994 2:197580089-197580111 TTTACCGCCCTAGACCCAGAGGG 0: 33
1: 60
2: 51
3: 36
4: 67
944250984_944250994 20 Left 944250984 2:197580046-197580068 CCCAGCCCAGTTCATGGCCCACT 0: 8
1: 56
2: 157
3: 266
4: 417
Right 944250994 2:197580089-197580111 TTTACCGCCCTAGACCCAGAGGG 0: 33
1: 60
2: 51
3: 36
4: 67
944250990_944250994 2 Left 944250990 2:197580064-197580086 CCACTTGGCAACAACCCTTAGAT No data
Right 944250994 2:197580089-197580111 TTTACCGCCCTAGACCCAGAGGG 0: 33
1: 60
2: 51
3: 36
4: 67
944250989_944250994 3 Left 944250989 2:197580063-197580085 CCCACTTGGCAACAACCCTTAGA No data
Right 944250994 2:197580089-197580111 TTTACCGCCCTAGACCCAGAGGG 0: 33
1: 60
2: 51
3: 36
4: 67
944250985_944250994 19 Left 944250985 2:197580047-197580069 CCAGCCCAGTTCATGGCCCACTT 0: 8
1: 55
2: 152
3: 264
4: 435
Right 944250994 2:197580089-197580111 TTTACCGCCCTAGACCCAGAGGG 0: 33
1: 60
2: 51
3: 36
4: 67
944250988_944250994 14 Left 944250988 2:197580052-197580074 CCAGTTCATGGCCCACTTGGCAA No data
Right 944250994 2:197580089-197580111 TTTACCGCCCTAGACCCAGAGGG 0: 33
1: 60
2: 51
3: 36
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944250994 Original CRISPR TTTACCGCCCTAGACCCAGA GGG Intronic
900625382 1:3606148-3606170 TTTGCAGCCCTAGAGCCCGATGG - Intronic
902050880 1:13562844-13562866 TTTACCGCCCTAGACCCAGAGGG + Intergenic
902600440 1:17537314-17537336 TTTGGAACCCTAGACCCAGAGGG + Intergenic
902970455 1:20044472-20044494 TTTACAGCCTTGGACCCAGAGGG - Intronic
903396063 1:23002709-23002731 CTTACTGCCCTAGACACAGAGGG - Intergenic
904393923 1:30205368-30205390 TTTACCGCCCTAGACCCAGAGGG + Intergenic
905429248 1:37909629-37909651 TTTACCGCCCTAGACCCAGAGGG + Intronic
906049535 1:42858834-42858856 TTTACAGCCCTGGACCCAGAAGG + Intergenic
906378689 1:45317584-45317606 TTTACTGCCCTAGACCCCAAGGG + Intergenic
907293562 1:53434200-53434222 TTTACTGCCCTAGACACAGAGGG + Intergenic
909729394 1:78874220-78874242 TTTACTGCCCTAGATCCAGAGGG + Intergenic
910092389 1:83480549-83480571 TTTACCCCCCTTGACAGAGATGG + Intergenic
911071035 1:93832009-93832031 TTTACCGCCCTAGACCCAGAAGG + Intronic
911133622 1:94416821-94416843 ATTCCTGCCCTATACCCAGAAGG + Intergenic
911148030 1:94570619-94570641 TTTACTGCCCTAGACCCAGAAGG - Intergenic
911966890 1:104382146-104382168 TTTACTGCCCTAGACCCAGAAGG + Intergenic
913095815 1:115514330-115514352 TTTACAGCCCTAGACCCTGAAGG - Intergenic
916941755 1:169684816-169684838 TTTACAGCCTTGGACCCAGAGGG + Intronic
917749610 1:178041927-178041949 TTTACTGCCCTAGACCCAGAAGG + Intergenic
920427374 1:205889004-205889026 TTTACTGCCCTAGACCCAGAGGG - Intergenic
920901568 1:210114547-210114569 TTTACAGCCCCAGACCCTGAAGG - Intronic
920907975 1:210189258-210189280 TTTACCACCCTAGACCCAGAGGG + Intergenic
922046393 1:221949882-221949904 TTTACAGCTCTGGACCCAGAAGG + Intergenic
922363583 1:224844221-224844243 TTTACAGCCCTAGACTCGGAAGG - Intergenic
922368460 1:224887393-224887415 TTTACAGCCCTAGACCCAGAGGG + Intergenic
922598939 1:226835216-226835238 TTTACTGCCCTAGACCCAGAGGG + Intergenic
922845452 1:228680702-228680724 TTTACCGCCCTAGACCCAGAGGG - Intergenic
1063106449 10:2996750-2996772 TTTACCTCCTTAGACCCATAGGG - Intergenic
1065443176 10:25772593-25772615 TATACCGCCCTAGACCCAGAGGG - Intergenic
1066437397 10:35406987-35407009 TTTACCACCCTAGACCCAGAGGG - Intronic
1067360363 10:45573162-45573184 TTTACAGCCCTAGACCCTGAAGG + Intronic
1071187198 10:83059098-83059120 CTTACAGCCCTAGACCCAGAGGG + Intergenic
1072884491 10:99261566-99261588 TTTACTGTCCTAGACCCAGAAGG + Intergenic
1073013978 10:100383705-100383727 TTTACCGCCCTAGACCCAGAGGG + Intergenic
1073394585 10:103207513-103207535 TTTACAGCCCTAGACCCTGAAGG + Intergenic
1073683495 10:105729340-105729362 GTTATAGCCCTAGACCCTGAAGG + Intergenic
1077679113 11:4223007-4223029 TTTACTGCCCTAGACCCAGAAGG - Intergenic
1077688550 11:4319649-4319671 TTTACTGCCCTAGACCCAGAAGG - Intergenic
1081159671 11:39736338-39736360 TTTACTGCCCTAGACCCAGAGGG + Intergenic
1082197793 11:49325167-49325189 TTTACTGCCCTAGTCCCAGAGGG - Intergenic
1085325908 11:75606476-75606498 TCTGCCACCCAAGACCCAGATGG + Intronic
1085570155 11:77551881-77551903 TTTACCACCCTAGATCCAGAGGG + Intronic
1085627255 11:78082924-78082946 TTTATAGCCCTAGACCCTGAAGG + Intergenic
1086658025 11:89382959-89382981 TTTACCGCCCTAGACCCAGAGGG + Intronic
1087201785 11:95352887-95352909 TTTACTACCCTACACCCTGAGGG + Intergenic
1089335158 11:117717890-117717912 TTTACCAACCTAGTCCCAGGAGG + Intronic
1089471088 11:118720734-118720756 TTTACAGCCCTAGACCTAAAAGG - Intergenic
1089953263 11:122548884-122548906 TATACTGCCCTAGACCCAGAAGG + Intergenic
1092025672 12:5237760-5237782 GTAACCTACCTAGACCCAGAGGG - Intergenic
1093024290 12:14232528-14232550 TTTACCACCCTAGACCCACAGGG + Intergenic
1093302199 12:17471525-17471547 TTTACTGCCGTAGGGCCAGAGGG + Intergenic
1096753807 12:53782021-53782043 TTTACTTCCCTAGAATCAGAGGG - Intergenic
1097189713 12:57213646-57213668 GTTAGTGTCCTAGACCCAGAGGG - Intergenic
1097592393 12:61589185-61589207 TTTGCAGCCCTAGACCCTGAAGG + Intergenic
1098919871 12:76293409-76293431 TTTACTGCCCTAGACCCAGAGGG + Intergenic
1099872748 12:88369629-88369651 TTTACCGCCCTAGACCCAGAAGG + Intergenic
1102116837 12:110409419-110409441 TTTACCATCCTAGACCCAGAAGG - Intergenic
1102604431 12:114057792-114057814 TTTACCGCCCTAGACCCAGAGGG + Intergenic
1104257568 12:127153740-127153762 TTTACAGCCCTAGACCCTGAAGG + Intergenic
1105032178 12:132891641-132891663 TTTACCGCCCTAGACCCAGAAGG + Intronic
1107947333 13:45430992-45431014 TTTACAGCCCTAGAACTAGGTGG - Intergenic
1110387499 13:74931105-74931127 TTTCCAGCCATAGACTCAGAAGG + Intergenic
1117174125 14:53130413-53130435 TTTACCACCCTAGACCCAGAGGG + Intronic
1118966562 14:70592322-70592344 TTTAGAGCCCTATCCCCAGATGG - Intronic
1119248432 14:73132395-73132417 TTTACTGCCCTAGACCCAGAAGG - Intergenic
1119560324 14:75584433-75584455 TTTACCGCCCTAGACCCAGAGGG - Intronic
1121289381 14:92761813-92761835 TTTACAGCCCTAGACCCAGAGGG + Intergenic
1121586789 14:95068214-95068236 GTCACCGCCCTAGACTCACAGGG - Intergenic
1122507593 14:102241578-102241600 TTTACCGCCCTAGACCCAGAGGG + Intronic
1122820449 14:104342174-104342196 TTCACCGCCCTGGACCCAGCTGG + Intergenic
1124074168 15:26427059-26427081 TTTACCACCCCATACCCACAGGG + Intergenic
1125629183 15:41133461-41133483 TTTACAGCCTTGGACCCAGAGGG + Intergenic
1125849053 15:42886503-42886525 TTTACCGCCCTAGACCCAGGCGG + Intronic
1127706191 15:61549395-61549417 TTCACGGCCCAAGACTCAGAGGG + Intergenic
1129259400 15:74355877-74355899 TTTACAGCCCTAGACCCTGAAGG + Intronic
1131038525 15:89241882-89241904 TGTACAGCCCTAGACCCAAAGGG + Intergenic
1131164828 15:90134772-90134794 TTTACAGCCCTAGACCCTGAAGG + Intergenic
1131447704 15:92513460-92513482 TTTACAGCCCTAGACCCTGAAGG + Intergenic
1133036989 16:3039035-3039057 ATTACAGCCCTACTCCCAGAAGG + Intergenic
1133869585 16:9674877-9674899 TATACCACCCTAGACCCAGAGGG - Intronic
1135025449 16:18995887-18995909 TTTACTGTCCTAGATCCAGGAGG - Intronic
1135055048 16:19224887-19224909 CTTACTGTCCTAGAGCCAGAAGG + Intronic
1145080706 17:19892193-19892215 TTTACCACCCTAGACCCAGAGGG - Intergenic
1147631832 17:41937225-41937247 TTTACCACCATAGTCCCTGAAGG + Intronic
1149319481 17:55469432-55469454 TTTACCACCCTAGACCCAGAGGG + Intergenic
1149526800 17:57362631-57362653 TTTTCCCCCCTAGAACCACATGG - Intronic
1152453916 17:80401859-80401881 TTTACCGCCCTAGACCCAGAGGG + Intergenic
1154097361 18:11430572-11430594 TGTACTTCTCTAGACCCAGATGG + Intergenic
1155961959 18:32002557-32002579 TTTACCACCCTAGACCCAGAGGG + Intergenic
1158576734 18:58644714-58644736 CTTACTGCCCTAGACCCAGAGGG - Intergenic
1159236467 18:65680258-65680280 TTGACCTCCCTAGGCCCAGACGG - Intergenic
1161712005 19:5854060-5854082 TTTACCACCCTAGACCCAGAGGG + Intergenic
1162274213 19:9640142-9640164 TTTACAGCCCTAGACCCATGGGG - Intronic
1162286634 19:9743779-9743801 TTTACAGCACTAGACCAAGAGGG + Intergenic
1162331413 19:10032102-10032124 TATACAGCACTAGACCCTGAAGG - Intergenic
1162769599 19:12941116-12941138 TTTACCCCCAAAGACCTAGAAGG + Intronic
1163209608 19:15830756-15830778 TTTACAGCCCTAGACCCTGAAGG + Intergenic
1163900261 19:20094385-20094407 TTTACCGCCCTAGACCCAGAGGG - Intronic
1164080763 19:21859735-21859757 TTTACCCCCCTAGACCCAGAGGG + Intergenic
1164421586 19:28098427-28098449 TATCCTGCCCTATACCCAGAAGG + Intergenic
1166689819 19:44815646-44815668 TTTACCTCCCTAGACCCAAGAGG - Intronic
1166905833 19:46107811-46107833 TTTACTGCCCTAGACCCAGAGGG - Intergenic
1167099426 19:47394997-47395019 TATACCGCCCTAGACCCAGAAGG + Intergenic
1167901074 19:52622698-52622720 TTTACAGCCCTAGACCCTGAAGG + Intronic
1168248109 19:55124511-55124533 TTTACAGCCCTAGACCCTGAAGG + Intergenic
925718524 2:6806947-6806969 TTTCCTGTCCCAGACCCAGAGGG + Intergenic
930099118 2:47589428-47589450 TTTACAGCCTTGGACCCAGCAGG - Intergenic
931483978 2:62671666-62671688 TTCACCTCCCTGGACCCTGATGG - Intergenic
932159498 2:69447413-69447435 TTTACAGCCCTAGACACTGAAGG - Intergenic
935616081 2:105083327-105083349 TTTACAGCCTTGGACCCAAAGGG - Intronic
936870753 2:117132269-117132291 TTTAATACCCTAGATCCAGAAGG + Intergenic
939331873 2:140773546-140773568 TATACAGCCCCAGACCCAGAAGG - Intronic
940216778 2:151310784-151310806 TTTACTGCCCTAGACCCATAGGG + Intergenic
940726478 2:157341866-157341888 TTTACCGCTCTAGACCCAGAGGG - Intergenic
943061545 2:183045840-183045862 TTTACAGCCCTAGACCCAGAAGG + Intergenic
944250994 2:197580089-197580111 TTTACCGCCCTAGACCCAGAGGG + Intronic
945858082 2:215091539-215091561 TTTACTGCCCTAGACCCAGAGGG + Intronic
947926489 2:233926341-233926363 TTTACCCTCCAAGACCCAGATGG - Intronic
1168839224 20:898496-898518 TTCACAGCCCTAGACCCAGAGGG + Intronic
1168954075 20:1821996-1822018 TTTCCCTCCCTTGAGCCAGAGGG + Intergenic
1170408502 20:16064473-16064495 TTTGCCTCCCTAGGCCCAAAAGG + Intergenic
1172759840 20:37314273-37314295 TTAACTGTCCCAGACCCAGAAGG - Intronic
1172932509 20:38596492-38596514 TTTACCGCCCTAGACCCAGAGGG - Intergenic
1173394038 20:42661553-42661575 TTTTCCGCCCTAAGCCCAGGTGG + Intronic
1173651990 20:44672313-44672335 TTTACCGCCCTAGACCCAGAGGG + Intergenic
1173781688 20:45761743-45761765 TTTACCGCCCTAGACCCAGAGGG + Intronic
1174534742 20:51242403-51242425 TCAAAAGCCCTAGACCCAGATGG - Intergenic
1174916977 20:54663893-54663915 TGTCCTGCCCTATACCCAGAGGG - Intergenic
1176144831 20:63560954-63560976 CTGACACCCCTAGACCCAGAGGG + Intronic
1177063054 21:16397094-16397116 TTTACCGCCCTAGACCCAGAGGG - Intergenic
1180560912 22:16613585-16613607 TATACTGCCCTAGACCCAGAGGG + Intergenic
1182440537 22:30361367-30361389 TGTCCTGCCCTATACCCAGATGG - Intronic
1183635709 22:39061247-39061269 TTTACCGCCCTAGACCCAGAGGG - Intronic
949480567 3:4490923-4490945 TCTACCTCCCCTGACCCAGAAGG - Intergenic
952296834 3:32069550-32069572 TTTACCGCCCTAGACCCAGAGGG + Intronic
952895248 3:38074425-38074447 TTTACCGCCCTAGACCCAGAGGG - Intronic
953599479 3:44348755-44348777 TTTACTGCCCTAGACCCAGAGGG - Intronic
953834505 3:46331143-46331165 TTTACTGCCCTAGGTTCAGAGGG - Intergenic
954161801 3:48728100-48728122 TTTACAGCCCTAGACCCTGAAGG - Intronic
956233538 3:67042439-67042461 TTTACAACCCTAGACCCTGAAGG - Intergenic
957155154 3:76536411-76536433 TTTTCAGCCCTAAACCCTGAAGG - Intronic
957394327 3:79619765-79619787 TTTACCACCCTAGACCCAGAGGG + Intronic
957675285 3:83356840-83356862 TTTACATCCCTAGACCCTGAAGG - Intergenic
957904889 3:86542181-86542203 TTTACAGCCCTAGACCCTGAAGG - Intergenic
958676851 3:97276714-97276736 TTTATAGCCCTAGACCTAAAAGG - Intronic
958755493 3:98245935-98245957 TTTACAGCCCTAGACCCAGAGGG + Intergenic
961712758 3:128839949-128839971 TTTACCGCCCTAGACCCAGAGGG - Intergenic
963111877 3:141695019-141695041 TTTACCGCCCTAGACCCAGAAGG - Intergenic
963282720 3:143401309-143401331 GTTACCACCCTATACCCAAATGG - Intronic
963319702 3:143799234-143799256 TTTACTGCCCTAGACCCATAGGG + Intronic
964067832 3:152599317-152599339 TTTACTGCCCTAGACCCAGAGGG + Intergenic
964176082 3:153827034-153827056 TTTACTGCCCTAGACCCAGAGGG - Intergenic
967152095 3:186659949-186659971 TATACCGCCCTAGACCCAGAAGG + Intergenic
968413354 4:407603-407625 CTTTACGTCCTAGACCCAGAGGG - Intergenic
971552609 4:27975912-27975934 TTTACAGCTATAGACCCTGAAGG + Intergenic
973751082 4:54021755-54021777 TTTACTGCCCTAGACCCACAGGG + Intronic
974880374 4:67749539-67749561 TTTACCACCCTAACCACAGATGG + Intronic
978303266 4:107294179-107294201 TTTACCGCCCTAGACTCAGAGGG - Intergenic
980491388 4:133532918-133532940 CTTACCGCCCTAGACCCAGAAGG - Intergenic
980714377 4:136612234-136612256 TTTACAGCCCTAGACTCAGAGGG + Intergenic
981482766 4:145255282-145255304 TTTACCACCCTAGACCCAGAGGG - Intergenic
982318771 4:154058228-154058250 TTTACTGCCCTAGCCCCAGAGGG + Intergenic
984411680 4:179405166-179405188 TTTACCACCCTAGACCCAGAGGG + Intergenic
985079041 4:186245894-186245916 TTTACAGCCCTAGACCCAGAAGG - Intronic
985913302 5:2899197-2899219 TTTCCCACCGTGGACCCAGATGG + Intergenic
986369009 5:7062016-7062038 TTTACAGCCCTAGACCCTAAAGG - Intergenic
986502593 5:8416043-8416065 TTTACTGCCCTAGACCCAGAAGG + Intergenic
988199051 5:28047587-28047609 TTTACCACCCTAGACCCAGAGGG + Intergenic
989659885 5:43788090-43788112 TTTACCGCCCTAGACCCAGAGGG + Intergenic
989688939 5:44118472-44118494 TTTACCACCCTAGACCCAGAGGG - Intergenic
989803095 5:45569045-45569067 TGTCCTGCCCTACACCCAGAGGG + Intronic
990565164 5:57020744-57020766 TTTACCGCCCTAGACCCAGAAGG - Intergenic
991571113 5:68054211-68054233 TTTTACGCTCTAGAACCAGATGG - Intergenic
992452046 5:76884149-76884171 TTTACTGCCCTAGACCCAGAGGG - Intronic
992962462 5:81970059-81970081 GGTCCCGCCCTACACCCAGAAGG + Intergenic
994324834 5:98436515-98436537 TTTACCGCCCTAGACCCAGAGGG + Intergenic
994778989 5:104067925-104067947 TTTACCACCCTAGACACAGAGGG - Intergenic
995125202 5:108572207-108572229 TTTACCACCCTAGACACAGAGGG - Intergenic
996917648 5:128731520-128731542 TTTACAGCCCTAGACCCTGAAGG + Intronic
997157251 5:131573815-131573837 TTTACAGCCCTAGACCCAGAGGG + Intronic
997678901 5:135735418-135735440 TTTACAGCCCTAGACCTTGAAGG - Intergenic
997770667 5:136550085-136550107 TTTACCGCCCTAGACCCAGAGGG - Intergenic
1001354513 5:171006779-171006801 TTTACCACCCTAGACCCAGAGGG - Intronic
1003099698 6:3167803-3167825 TTTACCGCCCTAGACCCAGAAGG + Intergenic
1003127300 6:3365346-3365368 TAAACCGCCCTAGCTCCAGACGG + Intronic
1005786621 6:29250969-29250991 TTTACCGCCCTAGACCCAGAGGG - Intergenic
1007583360 6:42972956-42972978 TTTAATGGCCTAGACCAAGACGG - Intronic
1009752133 6:67887529-67887551 TATACAGCACTAGACCCTGAAGG - Intergenic
1013808130 6:114016076-114016098 TTTACCACCCTAGACCCAGAGGG - Intergenic
1014396024 6:120927163-120927185 TTTACCACCCTAGACCCAGAGGG + Intergenic
1017269771 6:152492160-152492182 TTTGCCGCCCTAGACCCAGAGGG + Intronic
1017922878 6:158886793-158886815 TTTACCGCCCTAGACCCACAGGG - Intronic
1018077554 6:160230441-160230463 TTTACAGCCCTAGACCCTGAAGG + Intronic
1020794169 7:12661540-12661562 TCTACCACCCTAGACCCATAGGG + Intergenic
1021172635 7:17415773-17415795 TTTACAGCCCTAGATCCTGAAGG + Intergenic
1021660582 7:22915092-22915114 TTTACCACCCCAGACCCAGAGGG + Intergenic
1024739291 7:52337382-52337404 TTTACTGCCCTAGACCCAGAGGG - Intergenic
1026790960 7:73331360-73331382 TTTTACACCCTAGAGCCAGAAGG - Intronic
1027354377 7:77341645-77341667 TTTACCACCCTAGACCCAGAAGG + Intronic
1028589951 7:92483549-92483571 TTTACAGCCCTAGACCCTGAAGG - Intergenic
1029317119 7:99725216-99725238 TTCACAGCCCTGGACCCAGAGGG + Intronic
1030163653 7:106532164-106532186 TTTACTGCCCTAGACCCAGAGGG - Intergenic
1030445814 7:109645851-109645873 TTTATAGCCCTAGACCCTGAAGG - Intergenic
1030880324 7:114869810-114869832 TTTACCACCCAAGACAAAGAAGG - Intergenic
1033625546 7:143106797-143106819 TTTACCACCCTAGACACAGAGGG + Intergenic
1034334090 7:150309305-150309327 TTTACAGCCCTAGACCCTCGAGG + Intronic
1036549620 8:9804889-9804911 TTTACAGCCCTAGACTCTGAAGG + Intergenic
1039261480 8:35776573-35776595 TTTATGGCCCCAGACACAGAAGG - Intronic
1039499037 8:38002440-38002462 TTGACTGCCCTAGACCCAGAGGG - Intergenic
1040647986 8:49421446-49421468 TTTACAGCCCTAGACCCTGAAGG + Intergenic
1041651880 8:60310264-60310286 TTTACACCCCTAGACCCTGGAGG - Intergenic
1042706044 8:71666378-71666400 TTTATAGCCCTAGACCCTGAAGG + Intergenic
1043562154 8:81505932-81505954 TTTACAGCACTAGACTAAGACGG + Intergenic
1043597491 8:81902269-81902291 TTTACAGCCCTAGACCTTGAAGG - Intergenic
1043598805 8:81915394-81915416 TTTACAGCCCTAGACCCAGAAGG + Intergenic
1046074864 8:109302787-109302809 TTTACCGCCCTAGACCCAGAGGG + Intronic
1048652167 8:136490184-136490206 ATTCCCCCCCTATACCCAGAGGG - Intergenic
1050140437 9:2511381-2511403 TTTACCACCCTAGACCCATAGGG + Intergenic
1053059962 9:35023041-35023063 TTTACCGCCCTAGACCCAGAGGG - Intergenic
1053078501 9:35154969-35154991 TTTATTGCCCTAGACCCAGAGGG - Intergenic
1053134172 9:35638982-35639004 TTTACCGCCCTAGACCCAGAGGG + Intronic
1056363664 9:85882638-85882660 TTTACCACCCTAGACCCATAGGG + Intergenic
1060226158 9:121792270-121792292 TATACCGCCCTAGACCCAGAGGG + Intergenic
1061160133 9:128889040-128889062 TTTACAGACCAAGCCCCAGAGGG + Intronic
1062100558 9:134726132-134726154 TCACCCGCCCTAGACCCCGAGGG - Intronic
1062691532 9:137844688-137844710 TTTACCACCCTAGACCCAGAGGG + Intronic
1187103808 X:16220556-16220578 TTTACTGCCTTAGACCCAGAGGG - Intergenic
1188201004 X:27292906-27292928 TTTAGAGACCTAGACCCTGAAGG - Intergenic
1188333065 X:28896352-28896374 TTTAGAGCCCTAGACCCTAAAGG - Intronic
1188463415 X:30452830-30452852 TTTACAGCCCTAGACACTGAAGG - Intergenic
1188891053 X:35611401-35611423 TTTACCATTCTAGACCCACAGGG + Intergenic
1189031851 X:37459547-37459569 TTTACAGCCCTAGACCCTGAAGG - Intronic
1191014238 X:55792041-55792063 TTTACCACCCTAGACCCAGAGGG - Intergenic
1191805854 X:65133396-65133418 TTTACCACCCTAGACCCAGAAGG - Intergenic
1192454554 X:71266155-71266177 TTTACCACCCTAGACCCAGAGGG + Intergenic
1192706104 X:73529613-73529635 TTTACAGCCCTAGACCCTGAAGG + Intergenic
1192764635 X:74128574-74128596 TTTACAGCCTTAGACCCAGAGGG - Intergenic
1192914175 X:75636023-75636045 TTTACCACCCTAGACCCAGAGGG - Intergenic
1193537058 X:82728834-82728856 TTTATCACCCTAGACCCAGAGGG + Intergenic
1195016995 X:100790182-100790204 TTTACTGCCCTAGACCCAGAAGG - Intergenic
1196469871 X:116012629-116012651 TTTACAGCCTTAGACCCTGAAGG + Intergenic
1200007871 X:153099773-153099795 TTTACCACCCTAGACCCAGAGGG - Intergenic
1200812809 Y:7502680-7502702 TTTACCACCCTAGAGCCAGAGGG + Intergenic
1201061702 Y:10052055-10052077 TTTACTGTCCTAAACCCAGAGGG - Intergenic
1201540671 Y:15101991-15102013 TTTACAGCCTTGGACCCAGAAGG - Intergenic
1201724854 Y:17140433-17140455 CTTACCACCCTAGACCCAGAAGG - Intergenic
1202062054 Y:20898520-20898542 TTTACCACGCTAGACCCAGAGGG + Intergenic