ID: 944250995

View in Genome Browser
Species Human (GRCh38)
Location 2:197580090-197580112
Sequence TTACCGCCCTAGACCCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 26, 1: 52, 2: 48, 3: 104, 4: 526}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944250985_944250995 20 Left 944250985 2:197580047-197580069 CCAGCCCAGTTCATGGCCCACTT 0: 8
1: 55
2: 152
3: 264
4: 435
Right 944250995 2:197580090-197580112 TTACCGCCCTAGACCCAGAGGGG 0: 26
1: 52
2: 48
3: 104
4: 526
944250990_944250995 3 Left 944250990 2:197580064-197580086 CCACTTGGCAACAACCCTTAGAT No data
Right 944250995 2:197580090-197580112 TTACCGCCCTAGACCCAGAGGGG 0: 26
1: 52
2: 48
3: 104
4: 526
944250984_944250995 21 Left 944250984 2:197580046-197580068 CCCAGCCCAGTTCATGGCCCACT 0: 8
1: 56
2: 157
3: 266
4: 417
Right 944250995 2:197580090-197580112 TTACCGCCCTAGACCCAGAGGGG 0: 26
1: 52
2: 48
3: 104
4: 526
944250987_944250995 16 Left 944250987 2:197580051-197580073 CCCAGTTCATGGCCCACTTGGCA No data
Right 944250995 2:197580090-197580112 TTACCGCCCTAGACCCAGAGGGG 0: 26
1: 52
2: 48
3: 104
4: 526
944250988_944250995 15 Left 944250988 2:197580052-197580074 CCAGTTCATGGCCCACTTGGCAA No data
Right 944250995 2:197580090-197580112 TTACCGCCCTAGACCCAGAGGGG 0: 26
1: 52
2: 48
3: 104
4: 526
944250989_944250995 4 Left 944250989 2:197580063-197580085 CCCACTTGGCAACAACCCTTAGA No data
Right 944250995 2:197580090-197580112 TTACCGCCCTAGACCCAGAGGGG 0: 26
1: 52
2: 48
3: 104
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944250995 Original CRISPR TTACCGCCCTAGACCCAGAG GGG Intronic
900722582 1:4186991-4187013 TTACAGCCCTAGACCCTAAAAGG - Intergenic
900840750 1:5046824-5046846 TTACAGCCCTAGACCCTAAAAGG + Intergenic
900847434 1:5115095-5115117 TTACAGCCCTAGACCCTAAAAGG + Intergenic
900954780 1:5879958-5879980 GTCCCGTCCTAGACGCAGAGGGG + Intronic
902050881 1:13562845-13562867 TTACCGCCCTAGACCCAGAGGGG + Intergenic
903396062 1:23002708-23002730 TTACTGCCCTAGACACAGAGGGG - Intergenic
904393924 1:30205369-30205391 TTACCGCCCTAGACCCAGAGGGG + Intergenic
904711598 1:32434297-32434319 TTACAGCCCTAGACCCTAAAAGG + Intergenic
905060558 1:35136064-35136086 TTACAGCCCTAGACCCTAAAAGG - Intergenic
905429249 1:37909630-37909652 TTACCGCCCTAGACCCAGAGGGG + Intronic
905499744 1:38427058-38427080 TTACAGCCCTAGACCCTAAAAGG + Intergenic
906049536 1:42858835-42858857 TTACAGCCCTGGACCCAGAAGGG + Intergenic
906378690 1:45317585-45317607 TTACTGCCCTAGACCCCAAGGGG + Intergenic
906744558 1:48212723-48212745 TTACAGCCCTAGACCCTAAAAGG - Intergenic
907293563 1:53434201-53434223 TTACTGCCCTAGACACAGAGGGG + Intergenic
907963483 1:59306454-59306476 TTACATCCTTAGACCCAAAGGGG + Intronic
908591990 1:65645608-65645630 TTACAGCCCTAGACCCTAAAAGG - Intergenic
908852367 1:68388242-68388264 TTACAGCCCTAGACCCTAAAAGG + Intergenic
909014677 1:70369348-70369370 TTACAACCCTAGACCCTGAAAGG + Intronic
909035434 1:70590257-70590279 TTACAGCCCTAGACCCTGAAAGG + Intergenic
909222696 1:72983566-72983588 TTACAGCCCTAGACCCTAAAAGG - Intergenic
909551059 1:76898533-76898555 TTACAGCCCTAGACCCTAAAAGG - Intronic
909729395 1:78874221-78874243 TTACTGCCCTAGATCCAGAGGGG + Intergenic
909776731 1:79492296-79492318 TTACAGCCCTAGACCCTAAAAGG - Intergenic
909793013 1:79700078-79700100 TTACAGCCCTAGACCCTAAAAGG - Intergenic
909978489 1:82071243-82071265 TTACAGCCCTAGACCCTAAAAGG - Intergenic
910820700 1:91342447-91342469 TTATCTCCATAGACACAGAGTGG + Intronic
911071036 1:93832010-93832032 TTACCGCCCTAGACCCAGAAGGG + Intronic
911148029 1:94570618-94570640 TTACTGCCCTAGACCCAGAAGGG - Intergenic
911759825 1:101601793-101601815 TTACAGCCCTAGACCCTAAAAGG - Intergenic
911983815 1:104597962-104597984 TTACAGCCCTAGACCCTAAAAGG + Intergenic
912296439 1:108474928-108474950 TTACAGCCCTAGACCCTAAAAGG + Intergenic
912625151 1:111200199-111200221 TGACCACACTAGCCCCAGAGAGG + Intronic
912813522 1:112811390-112811412 TTACAGCCCTAGACCCTGAAAGG + Intergenic
913095814 1:115514329-115514351 TTACAGCCCTAGACCCTGAAGGG - Intergenic
915139452 1:153758210-153758232 TTCCCACCCTAGGCACAGAGAGG - Intronic
915918216 1:159954013-159954035 TTACTGGCCCAGACCCAGTGGGG + Intronic
916317403 1:163465104-163465126 TAATCACCCTACACCCAGAGAGG - Intergenic
916941756 1:169684817-169684839 TTACAGCCTTGGACCCAGAGGGG + Intronic
917749611 1:178041928-178041950 TTACTGCCCTAGACCCAGAAGGG + Intergenic
918347078 1:183615624-183615646 TTACAGCCCTAGACCCTAAAAGG + Intergenic
918714444 1:187769230-187769252 TTACAGCCCTAGACCCTAAAAGG - Intergenic
920427373 1:205889003-205889025 TTACTGCCCTAGACCCAGAGGGG - Intergenic
920829365 1:209450913-209450935 TTACAGCCCTAGACCCTAAAAGG + Intergenic
920901567 1:210114546-210114568 TTACAGCCCCAGACCCTGAAGGG - Intronic
920907976 1:210189259-210189281 TTACCACCCTAGACCCAGAGGGG + Intergenic
921212382 1:212911482-212911504 TTACAGCCCTAGACCCTAAAAGG + Intergenic
921459818 1:215413677-215413699 TTACAGCCCTAGACCCTAAAAGG - Intergenic
921520091 1:216147524-216147546 TTACAGCCCTAGACCCTAAAAGG + Intronic
922048375 1:221967932-221967954 TTACAGCCCTAGACCCTAAAAGG + Intergenic
922049571 1:221976840-221976862 TTACAGCCCTAGACCCTAAAAGG - Intergenic
922154107 1:223028140-223028162 TTACAGCCCTAGACCCTAAAAGG - Intergenic
922363582 1:224844220-224844242 TTACAGCCCTAGACTCGGAAGGG - Intergenic
922598940 1:226835217-226835239 TTACTGCCCTAGACCCAGAGGGG + Intergenic
923075169 1:230603206-230603228 TTACAGCCCTAGACCCTAAAAGG + Intergenic
924896218 1:248339963-248339985 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1062930715 10:1350697-1350719 TTACAGCCCTAGACCCTGAAAGG + Intronic
1063106448 10:2996749-2996771 TTACCTCCTTAGACCCATAGGGG - Intergenic
1063363077 10:5472750-5472772 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1063509637 10:6633329-6633351 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1063527720 10:6800826-6800848 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1064663848 10:17630579-17630601 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1064887030 10:20122894-20122916 TTACAGCCCTAGACCCTAAAAGG - Intronic
1065443175 10:25772592-25772614 ATACCGCCCTAGACCCAGAGGGG - Intergenic
1065610546 10:27467410-27467432 ATACTGCCCTAGACCCAGAAAGG + Intergenic
1066437396 10:35406986-35407008 TTACCACCCTAGACCCAGAGGGG - Intronic
1067360364 10:45573163-45573185 TTACAGCCCTAGACCCTGAAGGG + Intronic
1068058386 10:52037497-52037519 TTACAGCCCTAGACCCTAAAAGG - Intronic
1068179692 10:53502768-53502790 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1068230937 10:54168732-54168754 TTACAGCCCTAGACCCTAAAAGG + Intronic
1068592381 10:58864752-58864774 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1070474891 10:76820546-76820568 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1071187199 10:83059099-83059121 TTACAGCCCTAGACCCAGAGGGG + Intergenic
1071821704 10:89286645-89286667 TTACAGCCCTAGACCCTGAAAGG + Intronic
1071897768 10:90084775-90084797 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1071916166 10:90296982-90297004 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1072011316 10:91305253-91305275 TTACCGCCCTAGACCCTGAAAGG - Intergenic
1072597653 10:96889666-96889688 TTAACGCCCTAACCCCAGTGTGG - Intronic
1072884492 10:99261567-99261589 TTACTGTCCTAGACCCAGAAGGG + Intergenic
1073013979 10:100383706-100383728 TTACCGCCCTAGACCCAGAGGGG + Intergenic
1073394586 10:103207514-103207536 TTACAGCCCTAGACCCTGAAGGG + Intergenic
1073683496 10:105729341-105729363 TTATAGCCCTAGACCCTGAAGGG + Intergenic
1073709523 10:106021354-106021376 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1073933177 10:108599783-108599805 TTACAACCCTAGACCCTGAAAGG + Intergenic
1074018990 10:109564310-109564332 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1074740741 10:116482630-116482652 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1075013450 10:118893903-118893925 TTACCACCCTAGACCCAGAAAGG + Intergenic
1075248661 10:120846826-120846848 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1077519679 11:3025033-3025055 TCACTACCCTAGAACCAGAGTGG - Intronic
1077679112 11:4223006-4223028 TTACTGCCCTAGACCCAGAAGGG - Intergenic
1077688549 11:4319648-4319670 TTACTGCCCTAGACCCAGAAGGG - Intergenic
1077766421 11:5164046-5164068 TTACAGCCCTAGACCCTAAAAGG - Intronic
1077850832 11:6073572-6073594 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1077883315 11:6367758-6367780 CTACAGCCCTAGACCCTGAAAGG + Intergenic
1078046162 11:7915896-7915918 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1079447425 11:20569766-20569788 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1079672607 11:23187674-23187696 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1079727108 11:23890915-23890937 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1080227320 11:29975359-29975381 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1081159672 11:39736339-39736361 TTACTGCCCTAGACCCAGAGGGG + Intergenic
1082197792 11:49325166-49325188 TTACTGCCCTAGTCCCAGAGGGG - Intergenic
1084047128 11:66575573-66575595 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1084245635 11:67855170-67855192 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1084354159 11:68626077-68626099 AAACCGCCCTAGACCCAGGAAGG + Intergenic
1084355515 11:68635688-68635710 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1085570156 11:77551882-77551904 TTACCACCCTAGATCCAGAGGGG + Intronic
1085627256 11:78082925-78082947 TTATAGCCCTAGACCCTGAAGGG + Intergenic
1085934231 11:81123801-81123823 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1085987978 11:81808165-81808187 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1086004980 11:82027170-82027192 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1086125344 11:83343851-83343873 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1086133125 11:83421080-83421102 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1086134876 11:83435348-83435370 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1086550169 11:88045136-88045158 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1086658026 11:89382960-89382982 TTACCGCCCTAGACCCAGAGGGG + Intronic
1087314642 11:96589901-96589923 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1087839578 11:102907841-102907863 TTACAGCCCTAGACCCTAACAGG - Intergenic
1088554920 11:111052139-111052161 TTACAGCCCTAGACCCTTAAAGG + Intergenic
1089349059 11:117811259-117811281 TTACAGCCCTAGACCCTAAAAGG + Intronic
1089867089 11:121641688-121641710 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1089953264 11:122548885-122548907 ATACTGCCCTAGACCCAGAAGGG + Intergenic
1090107639 11:123869360-123869382 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1090526847 11:127546494-127546516 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1090546526 11:127772838-127772860 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1090850633 11:130568098-130568120 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1090926975 11:131258221-131258243 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1091183636 11:133628762-133628784 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1091886476 12:4020507-4020529 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1092474452 12:8806914-8806936 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1092626780 12:10336664-10336686 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1092723755 12:11465905-11465927 TTACAGCCCTAGACCCTAAAAGG - Intronic
1092739361 12:11613430-11613452 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1092789672 12:12060369-12060391 TTACAGCCCTAGACCCTAAAAGG + Intronic
1092924888 12:13263706-13263728 TTACAGCCCTAGACCCTAAGAGG - Intergenic
1093071199 12:14708605-14708627 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1093268048 12:17025439-17025461 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1093302200 12:17471526-17471548 TTACTGCCGTAGGGCCAGAGGGG + Intergenic
1093322027 12:17724035-17724057 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1093578781 12:20765353-20765375 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1093584554 12:20820737-20820759 TTACAGCCCTAGACCCTAAAAGG - Intronic
1093812877 12:23509773-23509795 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1093951034 12:25165099-25165121 TTACAGCCCTAGACCCTAAAAGG + Intronic
1094316093 12:29138760-29138782 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1094400632 12:30057926-30057948 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1095637618 12:44451746-44451768 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1095999068 12:48113883-48113905 TTACCACCCTAGACCCAGAGAGG - Intronic
1096753806 12:53782020-53782042 TTACTTCCCTAGAATCAGAGGGG - Intergenic
1096907217 12:54946662-54946684 TCACAGCCCTAGACCCTGAAAGG - Intergenic
1097542236 12:60955746-60955768 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1098173676 12:67770383-67770405 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1098402209 12:70087376-70087398 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1098630066 12:72712629-72712651 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1098653864 12:73005721-73005743 TTACGGCCCTAGACCCTAAAAGG - Intergenic
1098919872 12:76293410-76293432 TTACTGCCCTAGACCCAGAGGGG + Intergenic
1099872749 12:88369630-88369652 TTACCGCCCTAGACCCAGAAGGG + Intergenic
1101278435 12:103226415-103226437 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1102116836 12:110409418-110409440 TTACCATCCTAGACCCAGAAGGG - Intergenic
1102604432 12:114057793-114057815 TTACCGCCCTAGACCCAGAGGGG + Intergenic
1104257569 12:127153741-127153763 TTACAGCCCTAGACCCTGAAGGG + Intergenic
1104321774 12:127758295-127758317 TTACCCCCCAACCCCCAGAGAGG - Intergenic
1104531167 12:129572355-129572377 TTCCCGCCTTAGACCCTGTGTGG - Intronic
1105032179 12:132891642-132891664 TTACCGCCCTAGACCCAGAAGGG + Intronic
1106943407 13:34800620-34800642 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1107075540 13:36318419-36318441 TTACAGCCCTAGACCCTAAAAGG + Intronic
1107683179 13:42871149-42871171 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1108202662 13:48058332-48058354 TTACAGCCCTAGACCCTAAAAGG + Intronic
1108282106 13:48870884-48870906 TTACTGTCCTAGACCCAGAGAGG - Intergenic
1108512957 13:51171844-51171866 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1108803913 13:54131452-54131474 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1108814090 13:54268834-54268856 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1108919582 13:55658709-55658731 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1108947400 13:56042288-56042310 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1108952983 13:56116153-56116175 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1109352876 13:61206737-61206759 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1109709703 13:66145072-66145094 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1109716779 13:66230111-66230133 TTACGGCCCTAGACCCTAAAAGG - Intergenic
1110650520 13:77937094-77937116 TTACCGCCCTAGACCCAGAAAGG - Intergenic
1110765440 13:79276111-79276133 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1110845306 13:80185630-80185652 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1111302011 13:86360383-86360405 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1111362149 13:87190188-87190210 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1111458878 13:88516559-88516581 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1111630402 13:90841421-90841443 TTACAGCCCTAGACCATAAGAGG + Intergenic
1111631741 13:90852322-90852344 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1112236791 13:97644294-97644316 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1112496481 13:99909688-99909710 TGTCTGCCCTTGACCCAGAGGGG - Intergenic
1112889357 13:104211813-104211835 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1113324299 13:109267320-109267342 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1114221640 14:20702534-20702556 TTACTGTCCTAGACCCAGAGAGG + Intergenic
1114771085 14:25429442-25429464 TTACCGCCCTAGACCCAGAGAGG - Intergenic
1115904771 14:38192768-38192790 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1116179640 14:41517919-41517941 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1116573418 14:46545904-46545926 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1116613475 14:47106158-47106180 TTACAGCCCTAGACCCTAAAAGG + Intronic
1116702444 14:48259142-48259164 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1116703328 14:48266106-48266128 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1116952876 14:50895148-50895170 TTACAGCCCTAGACCCTAAAAGG + Intronic
1117174126 14:53130414-53130436 TTACCACCCTAGACCCAGAGGGG + Intronic
1117957953 14:61137184-61137206 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1119022392 14:71126279-71126301 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1119248431 14:73132394-73132416 TTACTGCCCTAGACCCAGAAGGG - Intergenic
1119317162 14:73705468-73705490 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1119560323 14:75584432-75584454 TTACCGCCCTAGACCCAGAGGGG - Intronic
1120438087 14:84503940-84503962 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1120539603 14:85736735-85736757 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1120618222 14:86733294-86733316 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1120659995 14:87238772-87238794 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1121193345 14:92048471-92048493 TTACCGCCCTAGACCCAGAATGG - Exonic
1121289382 14:92761814-92761836 TTACAGCCCTAGACCCAGAGGGG + Intergenic
1121586788 14:95068213-95068235 TCACCGCCCTAGACTCACAGGGG - Intergenic
1121703610 14:95974898-95974920 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1121980620 14:98450885-98450907 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1122040961 14:98987176-98987198 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1122215281 14:100199604-100199626 TCACCGCCCTAGACCCAACCTGG - Intergenic
1122381359 14:101309406-101309428 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1122507594 14:102241579-102241601 TTACCGCCCTAGACCCAGAGGGG + Intronic
1125045738 15:35240747-35240769 TTACAGCCCTAGACCCTAAAAGG + Intronic
1125131552 15:36289376-36289398 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1125213260 15:37239963-37239985 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1125629184 15:41133462-41133484 TTACAGCCTTGGACCCAGAGGGG + Intergenic
1125849054 15:42886504-42886526 TTACCGCCCTAGACCCAGGCGGG + Intronic
1126530193 15:49702871-49702893 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1126912441 15:53430568-53430590 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1128344934 15:66847758-66847780 TCACTGCCCCAGGCCCAGAGTGG + Intergenic
1129259401 15:74355878-74355900 TTACAGCCCTAGACCCTGAAGGG + Intronic
1129380014 15:75158783-75158805 TTGCTGCCCCACACCCAGAGTGG - Intergenic
1129882901 15:79018826-79018848 TTACCCTCCTAGGCCCAGGGAGG - Intronic
1130304518 15:82704202-82704224 TTACAGCCCTAGACCCTAAAAGG + Intronic
1130855078 15:87833245-87833267 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1130945982 15:88551236-88551258 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1131164829 15:90134773-90134795 TTACAGCCCTAGACCCTGAAGGG + Intergenic
1131447705 15:92513461-92513483 TTACAGCCCTAGACCCTGAAGGG + Intergenic
1131882553 15:96875567-96875589 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1132262975 15:100442236-100442258 TTACAGCCCTAGACCCTAAAAGG + Intronic
1132421261 15:101672143-101672165 TTACCCACCCAGACTCAGAGTGG - Intronic
1133651361 16:7816681-7816703 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1133765775 16:8836748-8836770 TTACAGCCCTAGACCCTAAAAGG - Intronic
1133869584 16:9674876-9674898 ATACCACCCTAGACCCAGAGGGG - Intronic
1134342217 16:13356301-13356323 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1138804911 16:60080810-60080832 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1139943088 16:70620199-70620221 TTACAGCCCTAGACCCTAAAAGG - Intronic
1139943758 16:70624517-70624539 TTACAGCCCTAGACCCTAAAAGG - Intronic
1140055942 16:71525894-71525916 TTACCTCCCTAGACCCAGGGTGG + Intronic
1141865242 16:86745756-86745778 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1145080705 17:19892192-19892214 TTACCACCCTAGACCCAGAGGGG - Intergenic
1146597859 17:34185251-34185273 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1149319482 17:55469433-55469455 TTACCACCCTAGACCCAGAGGGG + Intergenic
1151622449 17:75254525-75254547 TTACAGCCCTAGACCCTAAGAGG + Intronic
1151839793 17:76609686-76609708 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1152453917 17:80401860-80401882 TTACCGCCCTAGACCCAGAGGGG + Intergenic
1153742690 18:8145470-8145492 TTACCGCCCTACCCCCTGACAGG + Intronic
1155173783 18:23285997-23286019 TTACAGCCCTAGACCCTAAAAGG + Intronic
1155697055 18:28696833-28696855 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1155892725 18:31287987-31288009 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1155941509 18:31805762-31805784 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1155961960 18:32002558-32002580 TTACCACCCTAGACCCAGAGGGG + Intergenic
1156237317 18:35217716-35217738 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1156251969 18:35360071-35360093 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1156302206 18:35845850-35845872 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1156915778 18:42463521-42463543 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1156924093 18:42556248-42556270 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1156958144 18:42992847-42992869 TTACAGCCCTAGACCCTGAAAGG + Intronic
1156972306 18:43170990-43171012 TTACCACCCAAGAACAAGAGAGG - Intergenic
1158336340 18:56417569-56417591 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1158394678 18:57070358-57070380 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1158576733 18:58644713-58644735 TTACTGCCCTAGACCCAGAGGGG - Intergenic
1159164429 18:64683619-64683641 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1159835014 18:73326615-73326637 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1159929182 18:74294415-74294437 TTACCGCCCTAGACCCAGAGAGG + Intergenic
1161711175 19:5849036-5849058 TTACAGCCCTAGACCCTGAAAGG + Intronic
1162262171 19:9542169-9542191 TTACCACCCTAGAACCAGAGAGG + Intergenic
1162274212 19:9640141-9640163 TTACAGCCCTAGACCCATGGGGG - Intronic
1162286635 19:9743780-9743802 TTACAGCACTAGACCAAGAGGGG + Intergenic
1163209609 19:15830757-15830779 TTACAGCCCTAGACCCTGAAGGG + Intergenic
1163900260 19:20094384-20094406 TTACCGCCCTAGACCCAGAGGGG - Intronic
1163944488 19:20522811-20522833 TTACCGCCCTAGACCCAGAAAGG - Intergenic
1164080764 19:21859736-21859758 TTACCCCCCTAGACCCAGAGGGG + Intergenic
1164152937 19:22570219-22570241 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1164258723 19:23551216-23551238 TTACTGCCCTAGACCCAGAGAGG + Intronic
1164459268 19:28433621-28433643 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1164548659 19:29189733-29189755 TTACAGCCCCAGGCACAGAGAGG + Intergenic
1165497041 19:36159137-36159159 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1166905832 19:46107810-46107832 TTACTGCCCTAGACCCAGAGGGG - Intergenic
1167099427 19:47394998-47395020 ATACCGCCCTAGACCCAGAAGGG + Intergenic
1167901075 19:52622699-52622721 TTACAGCCCTAGACCCTGAAGGG + Intronic
1167902110 19:52629750-52629772 TTACAGCCCTAGACCCTAAAAGG + Intronic
1168051602 19:53833587-53833609 ATACCGCCCTAGACCCTAAAAGG + Intergenic
1168248110 19:55124512-55124534 TTACAGCCCTAGACCCTGAAGGG + Intergenic
925433888 2:3819635-3819657 TTACAGCCGTAGACCCTGAAAGG - Intronic
925544516 2:5002958-5002980 TTACAGCCCTAGACCCTAAAAGG + Intergenic
925828857 2:7876393-7876415 TTACAGCCCTAGACCCTAAAAGG - Intergenic
926407736 2:12571736-12571758 TTACAGCCCTAGACCCTAAAAGG + Intergenic
926413552 2:12628480-12628502 TTACAGCCCTAGACCCTAAAAGG + Intergenic
926464130 2:13167722-13167744 TTACAGCCCTAGACCCTAAAAGG - Intergenic
926815586 2:16795672-16795694 TTACAGCCCTAGACCCTAAAAGG - Intergenic
928322517 2:30295031-30295053 TTACAGCCCTAGAACCAGGACGG - Intronic
928770138 2:34695796-34695818 TTACAGCCCTAGACCCTGAAAGG + Intergenic
928778269 2:34791686-34791708 TTACAGCCCTAGACCCTAAAAGG + Intergenic
928827695 2:35440851-35440873 TTACAGCCCTAGACCCTAAAAGG - Intergenic
928857129 2:35815035-35815057 TTACAGCCCTAGACCCTGAAAGG + Intergenic
928928524 2:36601014-36601036 TTACAGCCCTAGACCCTAAAAGG + Intronic
929004870 2:37384732-37384754 TTACAGCCCTAGACCCTGAAAGG - Intergenic
929076710 2:38084497-38084519 TTACAGCCCTAGACCCTAAAAGG - Intronic
929793102 2:45038167-45038189 TTACAGCCCTAGACCCTAAAAGG - Intergenic
930955060 2:57194945-57194967 TTACAGCCCTAGACCCTAAAAGG + Intergenic
930958341 2:57230835-57230857 TTACAGCCCTAGACCCTGAAAGG + Intergenic
931026430 2:58117144-58117166 TTACAGCCCTAGACCCTAAAAGG - Intronic
931236905 2:60419602-60419624 TTACAGCCCTAGACCCTAAAAGG + Intergenic
931608967 2:64078926-64078948 TTACAGCCCTAGACCCTAAAAGG - Intergenic
931717373 2:65039789-65039811 TTACCACCCTAGGCCTACAGAGG + Intergenic
931850389 2:66245907-66245929 TTACAGCCCTAGACCCTAAAAGG + Intergenic
932159497 2:69447412-69447434 TTACAGCCCTAGACACTGAAGGG - Intergenic
932295817 2:70622606-70622628 TTACAGCCCTAGACCCTAAAAGG + Intronic
932358853 2:71088775-71088797 TTACAGCCCTAGACCCTAAAAGG - Intergenic
932367685 2:71163414-71163436 TTACAGCCCTAGACCCTAAAAGG - Intergenic
933013053 2:77090355-77090377 TTACAGCCCTAGACCCTAAAAGG + Intronic
933137893 2:78759850-78759872 TTACCGCCCTAGACCCAGAGAGG + Intergenic
933179806 2:79215577-79215599 TTACAGCCCTAGACCCTAAAAGG - Intronic
933329557 2:80878198-80878220 TTACAGCCCTAGACCCTAAGAGG - Intergenic
933552431 2:83792641-83792663 TTACAGCCCTAGACCCTAAAAGG - Intergenic
936883296 2:117280720-117280742 TTACAGCCCTAGACCCTAAAAGG + Intergenic
939307371 2:140428096-140428118 TTACAGCCCTAGACCCTAAAAGG + Intronic
940182901 2:150955016-150955038 TTACAGCCTTGGACCCAGAGAGG + Intergenic
940216779 2:151310785-151310807 TTACTGCCCTAGACCCATAGGGG + Intergenic
940508833 2:154586994-154587016 TTACAGCCCTAGACCCTAAAAGG - Intergenic
940726477 2:157341865-157341887 TTACCGCTCTAGACCCAGAGGGG - Intergenic
940885718 2:158987837-158987859 TTCCCGCCCAAGATTCAGAGTGG - Intronic
941340363 2:164297832-164297854 TTACAGCCCTAGACCCTAAAAGG + Intergenic
941353347 2:164461093-164461115 TTACAGCCCTAGACCCTAAAAGG + Intergenic
941456222 2:165714227-165714249 TTACAGCCCTAGACCCTAAAAGG - Intergenic
942097047 2:172543691-172543713 TTACAGCCCTAGACCCTAAAAGG + Intergenic
942462652 2:176178789-176178811 ATACCGCTCTACACCCAGAGAGG + Intergenic
942579678 2:177404261-177404283 TTACCCCCATAGACCCAGGCAGG - Intronic
942730332 2:179055507-179055529 TTACAGCCCTAGACCCTAAAAGG - Intergenic
943412968 2:187564210-187564232 TTACAGCCCTAGACCCTAAAAGG - Intronic
943806613 2:192132399-192132421 TTACAGCCCTAGACCCTAAAAGG + Intronic
943835364 2:192509438-192509460 TTACAGCCCTAGACCCTAAAAGG + Intergenic
943951331 2:194134646-194134668 TTACAGCCCTAGACCCTGAAAGG - Intergenic
944250995 2:197580090-197580112 TTACCGCCCTAGACCCAGAGGGG + Intronic
944387413 2:199181351-199181373 TTACAGCCCTAGACCCTAAAAGG + Intergenic
944394100 2:199248904-199248926 TTACAGCCCTAGACCCTAAAAGG + Intergenic
944876163 2:203965648-203965670 TTACAGCCCTAGACCCTAAAAGG - Intergenic
945153139 2:206810588-206810610 TTACAGCCCTAGACCCTAAAAGG - Intergenic
945173414 2:207019194-207019216 TTACAGCCCTAGACCCTAAAAGG + Intergenic
945301523 2:208219994-208220016 TTACAGCCCTAGACCCTAAAAGG - Intergenic
945361607 2:208901200-208901222 TTACAGCCCTAGACCCTAAAAGG + Intergenic
945394265 2:209301203-209301225 TTACAGCCCTAGACCCTAAAAGG + Intergenic
945554654 2:211263447-211263469 TTACCACCCTAGACCCAGAGAGG + Intergenic
945858083 2:215091540-215091562 TTACTGCCCTAGACCCAGAGGGG + Intronic
945938278 2:215924350-215924372 TTACAGCCCTAGACCCTAAAAGG + Intergenic
946781082 2:223193599-223193621 TTACAGCCCTAGACCCTAAAAGG - Intronic
946871798 2:224091608-224091630 TTACAGCCCTAGACCCTAAAAGG - Intergenic
946886461 2:224227269-224227291 TTACAGCCCTAGACCCTAAAAGG + Intergenic
946893235 2:224298654-224298676 TTACAGCCCTAGACCCTAAAAGG + Intergenic
948390646 2:237608934-237608956 TTACAGCCCTAGACCCTAAAAGG + Intergenic
948853806 2:240720931-240720953 GTACCGCCCTTCAACCAGAGAGG + Exonic
1168739305 20:174472-174494 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1168839225 20:898497-898519 TCACAGCCCTAGACCCAGAGGGG + Intronic
1170106197 20:12755851-12755873 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1170325527 20:15151592-15151614 TTACAGCCCTAGACCCTAAAAGG - Intronic
1170820739 20:19754877-19754899 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1172932508 20:38596491-38596513 TTACCGCCCTAGACCCAGAGGGG - Intergenic
1173101873 20:40095320-40095342 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1173118835 20:40271036-40271058 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1173651991 20:44672314-44672336 TTACCGCCCTAGACCCAGAGGGG + Intergenic
1173781689 20:45761744-45761766 TTACCGCCCTAGACCCAGAGGGG + Intronic
1175341314 20:58231812-58231834 TTGCAGCCCTAGAACCAAAGCGG - Intergenic
1177031214 21:15983548-15983570 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1177063053 21:16397093-16397115 TTACCGCCCTAGACCCAGAGGGG - Intergenic
1177119526 21:17123441-17123463 TTACAGCCCCAGACCCTGAAAGG + Intergenic
1177840785 21:26231798-26231820 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1178445003 21:32631655-32631677 TTCCCACCCCAGACCCAAAGAGG - Exonic
1179015324 21:37590769-37590791 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1179387517 21:40956929-40956951 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1180560913 22:16613586-16613608 ATACTGCCCTAGACCCAGAGGGG + Intergenic
1182221759 22:28764274-28764296 ATCCCTCCCTAGACCCAGTGAGG - Intergenic
1182732238 22:32504768-32504790 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1183635708 22:39061246-39061268 TTACCGCCCTAGACCCAGAGGGG - Intronic
949162135 3:894400-894422 TTACAGCCCTAGACCCTAAAAGG - Intergenic
949190433 3:1243543-1243565 TTACAGCCCTAGACCCTAAAAGG - Intronic
949671113 3:6399632-6399654 TTACAGCCCTAGACCCTAAAAGG + Intergenic
949827403 3:8178995-8179017 TTACAGCCCTAGACCCTAAAAGG + Intergenic
950926458 3:16746296-16746318 TTACAGCCCTAGACCCTAAAAGG + Intergenic
951298850 3:20971243-20971265 TTACAGCCCTAGACCCTAAAAGG - Intergenic
951332365 3:21382294-21382316 TTACAGCCCTAGACCCTGAAAGG - Intergenic
951889020 3:27551890-27551912 TTATAGCCCTAGACCCTGAAAGG - Intergenic
952895247 3:38074424-38074446 TTACCGCCCTAGACCCAGAGGGG - Intronic
952896094 3:38080011-38080033 TTACAGCCCTAGACCCTAAAAGG - Intronic
953077171 3:39581531-39581553 TTACAGCCCTAGACCCTAAAAGG - Intergenic
953177158 3:40562970-40562992 TTACAGCCCTAGACCCTAAAAGG + Intronic
953442613 3:42931725-42931747 TTACCTCCCAAGCCCCAGAATGG - Intronic
953599478 3:44348754-44348776 TTACTGCCCTAGACCCAGAGGGG - Intronic
953825742 3:46250025-46250047 TTACAGCCCTAGACCCTAAAAGG - Intronic
953834504 3:46331142-46331164 TTACTGCCCTAGGTTCAGAGGGG - Intergenic
954161800 3:48728099-48728121 TTACAGCCCTAGACCCTGAAGGG - Intronic
955253328 3:57305657-57305679 TTACAGCCCTAGACCCTAAAAGG + Intronic
955914773 3:63895632-63895654 TTACTGCCATAGCCCCTGAGTGG - Intronic
956233537 3:67042438-67042460 TTACAACCCTAGACCCTGAAGGG - Intergenic
956549029 3:70438621-70438643 TTACAGCCCTAGACCCTAAAAGG - Intergenic
956709179 3:72024940-72024962 TTACAGCCCTAGACCCTAAAAGG + Intergenic
957394328 3:79619766-79619788 TTACCACCCTAGACCCAGAGGGG + Intronic
957675284 3:83356839-83356861 TTACATCCCTAGACCCTGAAGGG - Intergenic
957734900 3:84191565-84191587 TTACAGCCCTGGACCCTGAAAGG - Intergenic
957904888 3:86542180-86542202 TTACAGCCCTAGACCCTGAAGGG - Intergenic
958421914 3:93939751-93939773 TTACCACCCTAGACCCTAAAAGG + Intronic
958750968 3:98192946-98192968 TTACAGCCCTAGACCCTGAAAGG + Intronic
958755494 3:98245936-98245958 TTACAGCCCTAGACCCAGAGGGG + Intergenic
959485809 3:106926461-106926483 TTAGAGCCCTAGACCCCAAGAGG - Intergenic
960282916 3:115797236-115797258 TTACAGCCCTAGACCCTAAAAGG - Intergenic
960310155 3:116109050-116109072 TTACAGCCCTAGACCCTAAAAGG - Intronic
961164802 3:124756284-124756306 TTACAGCCCTAGACCCTAAAAGG - Intergenic
961293470 3:125865655-125865677 TTACAGCCCTAGACCCTAAAAGG + Intergenic
961386193 3:126524634-126524656 TTACCTCCCCACTCCCAGAGCGG + Intronic
961711664 3:128832919-128832941 TTACAGCCCTAGACCCTAAAAGG - Intergenic
961712757 3:128839948-128839970 TTACCGCCCTAGACCCAGAGGGG - Intergenic
961730547 3:128961684-128961706 TTACAGCCCTAGACCCTAAAAGG + Intronic
961893751 3:130150898-130150920 TTACAGCCCTAGGCCCTAAGAGG - Intergenic
962205527 3:133431107-133431129 TTACAGCCCTAGACCCTAAAAGG + Intronic
962524003 3:136221643-136221665 TTACTGCCTTAGACCCAGAGAGG - Intergenic
962660589 3:137597425-137597447 TTACAGCCCTAGACCCTAAAAGG + Intergenic
963058580 3:141206917-141206939 TTACAGCCCTAGACCCTGAAAGG + Intergenic
963111876 3:141695018-141695040 TTACCGCCCTAGACCCAGAAGGG - Intergenic
963282719 3:143401308-143401330 TTACCACCCTATACCCAAATGGG - Intronic
963319703 3:143799235-143799257 TTACTGCCCTAGACCCATAGGGG + Intronic
963425178 3:145114932-145114954 TTACAGCCCTAGACCCTAAAAGG + Intergenic
963456699 3:145554907-145554929 TTACAGCCCTAGACCCTAAAAGG - Intergenic
963468574 3:145712350-145712372 TTACAGCCCTAGACCCTAAAAGG + Intergenic
963520407 3:146355504-146355526 TTACAGCCCTAGACCCTAAAAGG + Intergenic
963521585 3:146364006-146364028 TTACAGCCCTAGACCCTAAAAGG + Intergenic
963968568 3:151402558-151402580 TTCCCGCCCTAGGGCCAGTGGGG - Intronic
964067833 3:152599318-152599340 TTACTGCCCTAGACCCAGAGGGG + Intergenic
964125495 3:153230448-153230470 TTACAGCCCTAGACCCTAAAAGG - Intergenic
964176081 3:153827033-153827055 TTACTGCCCTAGACCCAGAGGGG - Intergenic
964906549 3:161725593-161725615 TTACAGCCCTAGACCCTAAAAGG - Intergenic
964940994 3:162157902-162157924 TTACAGCCCTAGACCCTGAAAGG - Intergenic
964984909 3:162726277-162726299 TTACAGCCCTAGACCCTAAAAGG - Intergenic
965070290 3:163909521-163909543 TTACAGCCCTAGACCCTAAAAGG + Intergenic
965262694 3:166504544-166504566 TTACAGCCCTAGACCCTAAAAGG - Intergenic
965286771 3:166827835-166827857 TTACAGCCCTAGACCCTAAAAGG - Intergenic
965336287 3:167433166-167433188 TTACAGCCCTAGACCCTAAAAGG + Intergenic
965457180 3:168917063-168917085 TGACTGCCTTAGGCCCAGAGTGG - Intergenic
965640080 3:170821712-170821734 TTACAGCCCTAGACCCTGAAAGG - Intronic
965713367 3:171578392-171578414 TTACGGCCCTAGACCCTAAAAGG + Intergenic
966066806 3:175829697-175829719 TTACAGCCCTAGACCCTAAAAGG + Intergenic
966105123 3:176325356-176325378 TTACAGCCCTAGACCCTAAAAGG - Intergenic
966232888 3:177669571-177669593 TTACAGCCCTAGACCCTAAAAGG - Intergenic
966279260 3:178209483-178209505 TTACAGCCCTAGACCCTAAAAGG + Intergenic
966397611 3:179518808-179518830 TTACAGCCCTAGACCCTGAAAGG + Intergenic
966398481 3:179524666-179524688 TTACAGCCCTAGGCCCTGAAAGG - Intergenic
967152096 3:186659950-186659972 ATACCGCCCTAGACCCAGAAGGG + Intergenic
967496184 3:190146483-190146505 TTACAGCCCTAGACCCTAAAAGG + Intergenic
967561348 3:190922083-190922105 TTACAGCCCTAGACCCTAAAAGG + Intergenic
967624686 3:191670219-191670241 TTACAGCCCTAGACCCTAAAAGG - Intergenic
967643873 3:191899128-191899150 TTACAGCCCTAGACCCTAAAAGG - Intergenic
967658146 3:192074816-192074838 TTACAGCCCTAGACCCTAAAAGG - Intergenic
968413353 4:407602-407624 TTTACGTCCTAGACCCAGAGGGG - Intergenic
969003851 4:4003974-4003996 TTACAGCCCTAGACCCTGAAAGG - Intergenic
969810077 4:9640850-9640872 TTACAGCCCTAGACCCTAAAAGG + Intergenic
970029278 4:11657490-11657512 TTACAGCCCTAGACCCTAAAAGG - Intergenic
970042050 4:11808224-11808246 TTACAGCCCTAGACCCTAAAAGG + Intergenic
971180521 4:24325188-24325210 TTACAGCCCTAGACCCTAAAAGG + Intergenic
971200101 4:24502986-24503008 TTACAGCCCTAGACCCTAAAAGG + Intergenic
973751083 4:54021756-54021778 TTACTGCCCTAGACCCACAGGGG + Intronic
974903743 4:68032595-68032617 TTACAGCCCTAGACCCTGAAAGG + Intergenic
976558530 4:86476534-86476556 TTAAAGCCCTAGACCCTGAAAGG + Intronic
976696496 4:87923843-87923865 TTACAGCCCTAGACCCTAAAAGG + Intergenic
976739996 4:88347483-88347505 TTACTGCCCTAGACCCAGAAAGG - Intergenic
976884610 4:89968528-89968550 TTACAGCCCTAGACCCTAAAAGG - Intergenic
977062547 4:92275227-92275249 TTACAGCCCTAGACCCTAAAAGG - Intergenic
977075247 4:92442697-92442719 TTACAGCCCTAGACCCTAAAAGG - Intronic
977123829 4:93139202-93139224 TTACAATCCTAAACCCAGAGGGG + Intronic
977198469 4:94088360-94088382 TTACAGCCCTAGACCCTAAAAGG - Intergenic
977217193 4:94296951-94296973 TTACAGCCCTAGACCCTAAAAGG - Intergenic
978031439 4:103943089-103943111 TTACAGCCCTAGACCCTAAAAGG + Intergenic
978303265 4:107294178-107294200 TTACCGCCCTAGACTCAGAGGGG - Intergenic
979054660 4:115979389-115979411 TTACAGCCCTAGACCCTAAAAGG - Intergenic
979146580 4:117254075-117254097 TTACAGCCCTAGACCCTAAAAGG + Intergenic
979379902 4:119995895-119995917 TTACAGCCCTAGACCCTAAAAGG + Intergenic
979850346 4:125565371-125565393 TTACAGCCCTAGACCCTAAAAGG - Intergenic
980003393 4:127515212-127515234 TTACAGCCCTAGACCCTGAAAGG - Intergenic
980284907 4:130769308-130769330 TTACAGCCCTAGACCCTAAAAGG + Intergenic
980388886 4:132120175-132120197 TTACAGCCCTAGACCCTAAAAGG + Intergenic
980491387 4:133532917-133532939 TTACCGCCCTAGACCCAGAAGGG - Intergenic
980714378 4:136612235-136612257 TTACAGCCCTAGACTCAGAGGGG + Intergenic
980903899 4:138929846-138929868 TTACAGCCCTAGACCCTAAAAGG + Intergenic
981040205 4:140215469-140215491 TTACAGCCCTAGACCCTAAAAGG + Intergenic
981384411 4:144111871-144111893 TTTACACCCTAGAACCAGAGAGG - Intronic
981525168 4:145701082-145701104 TTACAGCCCTAGACCCTAAAAGG + Intronic
981539684 4:145834720-145834742 TTACAGCCCTAGACCCTAAAAGG + Intronic
982084006 4:151816337-151816359 TTACAGCCCTAGACCCTAAAAGG - Intergenic
982180515 4:152745087-152745109 TTACAGCCCTAGACCCTAAAAGG - Intronic
982318772 4:154058229-154058251 TTACTGCCCTAGCCCCAGAGGGG + Intergenic
982497146 4:156107202-156107224 TTACAGCCCTAGACCCTAAAAGG - Intergenic
982535406 4:156602257-156602279 TTACAGCCCTAGACCCTAAAAGG + Intergenic
983055446 4:163095063-163095085 TTACAGCCCTAGACCCTAAAAGG + Intergenic
983883799 4:172960137-172960159 TTACAGCCCTAGACCCTGAAAGG - Intronic
984322147 4:178209097-178209119 TTACAGCCCTAGACCCTGAAAGG + Intergenic
985079040 4:186245893-186245915 TTACAGCCCTAGACCCAGAAGGG - Intronic
985389909 4:189483199-189483221 TTACAGCCCTAGACCCTAAAAGG - Intergenic
985582319 5:704765-704787 TTACAGCCCTAGACCCTAAAAGG + Intergenic
986193498 5:5517528-5517550 TTACAGCCCTAGACCCTAAAAGG + Intergenic
986502594 5:8416044-8416066 TTACTGCCCTAGACCCAGAAGGG + Intergenic
986555084 5:9002308-9002330 TTACAGCCCTAGACCCTAAAAGG - Intergenic
986919626 5:12666275-12666297 TTACAGCCCTAGACCCTAAAAGG - Intergenic
987282002 5:16421989-16422011 TTACAGCCCTAGACCCTAAAAGG + Intergenic
987755790 5:22096792-22096814 TTACAGCCCTAGACCCTGAAAGG + Intronic
988199052 5:28047588-28047610 TTACCACCCTAGACCCAGAGGGG + Intergenic
989615187 5:43331703-43331725 TTACTGTCCTAGACCCAGAGAGG - Intergenic
990565163 5:57020743-57020765 TTACCGCCCTAGACCCAGAAGGG - Intergenic
992394622 5:76359327-76359349 TTACAGCCCTAGACCCTAAAAGG + Intergenic
992452045 5:76884148-76884170 TTACTGCCCTAGACCCAGAGGGG - Intronic
992960791 5:81955233-81955255 TTACAGCCCTAGACCCTAAAAGG + Intergenic
993192675 5:84700454-84700476 TTACAGCCCTAGACCCTAAAAGG + Intergenic
993836666 5:92825955-92825977 TTACAGCCCTAGACCCTAAAAGG + Intergenic
994126149 5:96170635-96170657 TTACAGCCCTAGACCCTGAAAGG - Intergenic
994295105 5:98081013-98081035 TTACAGCCCTAGACCCTAAAAGG + Intergenic
994324835 5:98436516-98436538 TTACCGCCCTAGACCCAGAGGGG + Intergenic
994532582 5:100987989-100988011 TTACAGCCCTAGACCCTAAAAGG - Intergenic
994556891 5:101316888-101316910 TTACAGCCCTAGACCCTAAAAGG + Intergenic
994778988 5:104067924-104067946 TTACCACCCTAGACACAGAGGGG - Intergenic
995125201 5:108572206-108572228 TTACCACCCTAGACACAGAGGGG - Intergenic
995899406 5:117050101-117050123 TTACAGCCCTAGACCCTAAAAGG - Intergenic
995901127 5:117067428-117067450 TTTCCTCCCTGGACCCAGGGAGG - Intergenic
996052713 5:118950971-118950993 TTACCTTCCTAGACCCAGAAAGG - Intronic
996203298 5:120701326-120701348 TTACAGCCCTAGACCCTAAAAGG - Intergenic
996344863 5:122477340-122477362 TTACAGCCCTAGACCCTAAAAGG - Intergenic
996358667 5:122622634-122622656 TTACAGCCCTAGACCCTGAAAGG - Intergenic
996509867 5:124305745-124305767 TTACAGCCCTAGACCCTAAAAGG + Intergenic
996575043 5:124970358-124970380 TTACAACCCTAGACCCTGAAAGG - Intergenic
996726037 5:126674074-126674096 CTACTGCCCAAGACCCAGAGAGG - Intergenic
996745486 5:126843294-126843316 TTACAGCCCTAGACCCTAAAAGG - Intergenic
996917649 5:128731521-128731543 TTACAGCCCTAGACCCTGAAGGG + Intronic
997157252 5:131573816-131573838 TTACAGCCCTAGACCCAGAGGGG + Intronic
997746360 5:136303261-136303283 TTACAGCCCTAGACCCTAAAAGG + Intronic
997770666 5:136550084-136550106 TTACCGCCCTAGACCCAGAGGGG - Intergenic
999432261 5:151534605-151534627 TCACTGCCCTAGACCGAGAAAGG - Exonic
1000438546 5:161241917-161241939 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1000439681 5:161250441-161250463 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1000519449 5:162279112-162279134 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1000606891 5:163335995-163336017 TTACTGCCCTAGACCCAGAGAGG + Intergenic
1000885365 5:166742847-166742869 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1000935684 5:167301650-167301672 TTACAGCCCTAGACCCTAAAAGG - Intronic
1001331492 5:170765769-170765791 TTACAGCCCTAGACCCTAAAAGG - Intronic
1001354512 5:171006778-171006800 TTACCACCCTAGACCCAGAGGGG - Intronic
1002611004 5:180418461-180418483 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1003099699 6:3167804-3167826 TTACCGCCCTAGACCCAGAAGGG + Intergenic
1004106225 6:12669352-12669374 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1004283563 6:14300686-14300708 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1004575186 6:16887932-16887954 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1004836958 6:19540852-19540874 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1005014698 6:21365243-21365265 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1008476483 6:51940132-51940154 TTACAGCCCTAGACCCTAAAAGG + Intronic
1008687429 6:53941320-53941342 TAACCTCCCTGGACCCAGGGTGG + Intronic
1009269778 6:61602050-61602072 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1009464302 6:63951881-63951903 TTACAGCCCTAGACTCTGAAAGG + Intronic
1009750339 6:67872701-67872723 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1010826952 6:80486173-80486195 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1010841353 6:80651565-80651587 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1011175031 6:84550732-84550754 TGACCTGCCTAGACACAGAGAGG + Intergenic
1011770984 6:90673948-90673970 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1012014430 6:93833813-93833835 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1012315783 6:97781571-97781593 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1013808129 6:114016075-114016097 TTACCACCCTAGACCCAGAGGGG - Intergenic
1013843720 6:114426060-114426082 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1013891664 6:115033859-115033881 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1014115386 6:117663446-117663468 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1014360201 6:120466002-120466024 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1014396025 6:120927164-120927186 TTACCACCCTAGACCCAGAGGGG + Intergenic
1014555809 6:122841807-122841829 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1014614714 6:123586024-123586046 TTACAGCCCTAGACCCTAAAAGG - Intronic
1014718855 6:124894011-124894033 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1014794030 6:125705597-125705619 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1014891504 6:126850727-126850749 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1015165185 6:130194318-130194340 TTACAGCCCTAGACCCTAAAAGG + Intronic
1015266694 6:131297430-131297452 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1015269619 6:131325377-131325399 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1015271334 6:131340849-131340871 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1015288077 6:131508017-131508039 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1015323791 6:131903660-131903682 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1016535797 6:145106885-145106907 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1016650333 6:146454151-146454173 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1017269772 6:152492161-152492183 TTGCCGCCCTAGACCCAGAGGGG + Intronic
1017389458 6:153923459-153923481 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1017922877 6:158886792-158886814 TTACCGCCCTAGACCCACAGGGG - Intronic
1018077555 6:160230442-160230464 TTACAGCCCTAGACCCTGAAGGG + Intronic
1018084538 6:160290307-160290329 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1018495442 6:164342466-164342488 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1018521512 6:164655887-164655909 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1020323985 7:6960430-6960452 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1020532754 7:9357155-9357177 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1020794170 7:12661541-12661563 CTACCACCCTAGACCCATAGGGG + Intergenic
1021172636 7:17415774-17415796 TTACAGCCCTAGATCCTGAAGGG + Intergenic
1021393582 7:20122545-20122567 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1021429806 7:20547423-20547445 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1021637275 7:22705218-22705240 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1021660583 7:22915093-22915115 TTACCACCCCAGACCCAGAGGGG + Intergenic
1021810623 7:24398251-24398273 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1021977935 7:26027922-26027944 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1022114036 7:27247383-27247405 TTACCGCCAGATACCGAGAGAGG - Intergenic
1022119568 7:27294864-27294886 TTTTCTCCCAAGACCCAGAGAGG - Intergenic
1022372833 7:29786821-29786843 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1022447368 7:30481185-30481207 TTACAGCCCTAGACTCTGAAAGG + Intergenic
1022709029 7:32834341-32834363 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1022854749 7:34303628-34303650 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1023698927 7:42874343-42874365 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1024697582 7:51871992-51872014 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1027157842 7:75781100-75781122 TTACAGCCCTAGGCCCTGAAAGG + Intronic
1027158275 7:75783873-75783895 TTACAGCCCTACACCCTGAAAGG + Intronic
1027354378 7:77341646-77341668 TTACCACCCTAGACCCAGAAGGG + Intronic
1027851904 7:83461642-83461664 TTACAGCCCTAGACCCTAAAAGG + Intronic
1028586011 7:92452488-92452510 TGACCACCCAAGACCCAGAATGG + Intronic
1028589950 7:92483548-92483570 TTACAGCCCTAGACCCTGAAGGG - Intergenic
1028670472 7:93395906-93395928 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1029020093 7:97356425-97356447 TTACCTCCCCAAACCCAGAGAGG - Intergenic
1029317120 7:99725217-99725239 TCACAGCCCTGGACCCAGAGGGG + Intronic
1029500173 7:100924118-100924140 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1030163652 7:106532163-106532185 TTACTGCCCTAGACCCAGAGGGG - Intergenic
1030441728 7:109595790-109595812 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1030445813 7:109645850-109645872 TTATAGCCCTAGACCCTGAAGGG - Intergenic
1031004630 7:116457458-116457480 TTACAGCCCTAGACCCTAAAAGG + Intronic
1031337385 7:120552678-120552700 TAACCTCCCTACACTCAGAGGGG - Intronic
1031355234 7:120780879-120780901 TTACGGCCCTAGACCCTAAAAGG - Intergenic
1031364787 7:120889374-120889396 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1031399944 7:121317546-121317568 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1031422496 7:121567742-121567764 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1031525553 7:122818895-122818917 TTACAGCCCTAGACCCTAAAAGG + Intronic
1031685805 7:124731014-124731036 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1031777304 7:125919562-125919584 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1033084675 7:138330976-138330998 TTACCACCCTAGACCCAGAAAGG + Intergenic
1033211479 7:139463220-139463242 TTACAGCCCTAGACCCTGAAAGG + Intronic
1033465075 7:141582548-141582570 TTACAGCCCTAGATCCTGAAAGG - Intronic
1033625547 7:143106798-143106820 TTACCACCCTAGACACAGAGGGG + Intergenic
1033675991 7:143540958-143540980 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1033695844 7:143788481-143788503 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1033909505 7:146247115-146247137 TTACAGCCCTAGACCCTGAAAGG - Intronic
1035880706 8:3241979-3242001 TTACAGCCCTAGACCCTAAAAGG - Intronic
1036070966 8:5440399-5440421 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1036281442 8:7404412-7404434 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1036340027 8:7907160-7907182 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1036472374 8:9063201-9063223 TTACAGCCCTAGACCCTAAAAGG - Intronic
1036549621 8:9804890-9804912 TTACAGCCCTAGACTCTGAAGGG + Intergenic
1036639451 8:10573221-10573243 TTACAGCCCTAGACCCTAAGAGG + Intergenic
1036712758 8:11092454-11092476 CTACCCCCCTAAACCTAGAGGGG - Intronic
1039499036 8:38002439-38002461 TGACTGCCCTAGACCCAGAGGGG - Intergenic
1040647987 8:49421447-49421469 TTACAGCCCTAGACCCTGAAGGG + Intergenic
1041917578 8:63152064-63152086 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1042453516 8:68975145-68975167 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1042706045 8:71666379-71666401 TTATAGCCCTAGACCCTGAAGGG + Intergenic
1042707329 8:71676886-71676908 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1043597490 8:81902268-81902290 TTACAGCCCTAGACCTTGAAGGG - Intergenic
1043598806 8:81915395-81915417 TTACAGCCCTAGACCCAGAAGGG + Intergenic
1043717935 8:83508877-83508899 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1043837694 8:85064915-85064937 TTACAGCCCTAAACCCTGAAAGG + Intergenic
1044148553 8:88745951-88745973 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1044258655 8:90093942-90093964 TTACAGCCCTAGACCCTAAAAGG - Intronic
1044921948 8:97177054-97177076 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1045197481 8:99945844-99945866 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1045644741 8:104287908-104287930 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1046074865 8:109302788-109302810 TTACCGCCCTAGACCCAGAGGGG + Intronic
1046294080 8:112197796-112197818 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1046559242 8:115816582-115816604 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1047699306 8:127433702-127433724 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1048135428 8:131742673-131742695 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1048143729 8:131821130-131821152 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1048585461 8:135770883-135770905 TTACAGCCCTAGACCCTAAATGG - Intergenic
1048728465 8:137412038-137412060 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1049353286 8:142175573-142175595 TTACAGGCCCAGGCCCAGAGAGG + Intergenic
1050117563 9:2277541-2277563 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1050474127 9:6021946-6021968 GTACAGCCCTAGACCCTGAAAGG + Intergenic
1050896030 9:10886710-10886732 TTACAGCCCTAGACTCTGAAAGG + Intergenic
1051052585 9:12950295-12950317 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1051849326 9:21489437-21489459 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1052287840 9:26806846-26806868 ATACCGCCCTGGCCACAGAGAGG - Intergenic
1052720681 9:32168280-32168302 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1053057984 9:35005431-35005453 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1053059961 9:35023040-35023062 TTACCGCCCTAGACCCAGAGGGG - Intergenic
1053134173 9:35638983-35639005 TTACCGCCCTAGACCCAGAGGGG + Intronic
1053425700 9:38008643-38008665 TTCCTGCCCGAGGCCCAGAGAGG - Intronic
1055233020 9:74087638-74087660 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1055347762 9:75355543-75355565 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1055626682 9:78182757-78182779 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1056044778 9:82704447-82704469 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1056061120 9:82885732-82885754 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1056323844 9:85460621-85460643 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1056363665 9:85882639-85882661 TTACCACCCTAGACCCATAGGGG + Intergenic
1056437279 9:86587046-86587068 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1056522406 9:87412901-87412923 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1056600322 9:88042061-88042083 TTCCCACCCAAGACCCACAGTGG - Intergenic
1057377952 9:94541802-94541824 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1057683959 9:97216818-97216840 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1057812622 9:98269573-98269595 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1058026245 9:100144429-100144451 TTACAGCCCTAGACCCTAAAAGG - Intronic
1058335462 9:103822870-103822892 TTACAGCACTTGACCCTGAGTGG - Intergenic
1058430982 9:104919139-104919161 TTACCGACCTACCCCCAGTGAGG + Intronic
1059546202 9:115178382-115178404 TTACAGCCCTAGACCCTAAAAGG - Intronic
1060737926 9:126078390-126078412 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1061583019 9:131549036-131549058 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1062691533 9:137844689-137844711 TTACCACCCTAGACCCAGAGGGG + Intronic
1185858471 X:3556863-3556885 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1185960726 X:4544223-4544245 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1185991019 X:4893565-4893587 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1186784027 X:12941776-12941798 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1187086564 X:16048422-16048444 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1187100000 X:16182913-16182935 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1188419443 X:29977234-29977256 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1188463414 X:30452829-30452851 TTACAGCCCTAGACACTGAAGGG - Intergenic
1188552610 X:31379462-31379484 TTACAGCCCTAGACCCTAAAAGG + Intronic
1188891054 X:35611402-35611424 TTACCATTCTAGACCCACAGGGG + Intergenic
1189031850 X:37459546-37459568 TTACAGCCCTAGACCCTGAAGGG - Intronic
1191014237 X:55792040-55792062 TTACCACCCTAGACCCAGAGGGG - Intergenic
1191805853 X:65133395-65133417 TTACCACCCTAGACCCAGAAGGG - Intergenic
1192454555 X:71266156-71266178 TTACCACCCTAGACCCAGAGGGG + Intergenic
1192706105 X:73529614-73529636 TTACAGCCCTAGACCCTGAAGGG + Intergenic
1192764634 X:74128573-74128595 TTACAGCCTTAGACCCAGAGGGG - Intergenic
1192914174 X:75636022-75636044 TTACCACCCTAGACCCAGAGGGG - Intergenic
1193537059 X:82728835-82728857 TTATCACCCTAGACCCAGAGGGG + Intergenic
1193941457 X:87683865-87683887 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1194186288 X:90777054-90777076 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1194308578 X:92276797-92276819 TTACAGCCCTAGACCCTAAAAGG - Intronic
1194351251 X:92826475-92826497 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1194503020 X:94702553-94702575 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1194873839 X:99163171-99163193 TTACAGCCCTAGACCCCAAAAGG - Intergenic
1195016994 X:100790181-100790203 TTACTGCCCTAGACCCAGAAGGG - Intergenic
1195326905 X:103765535-103765557 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1195841444 X:109180377-109180399 TTACAGCCCTAAACCCTGAAAGG + Intergenic
1195908718 X:109868949-109868971 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1196073044 X:111545893-111545915 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1196165506 X:112532592-112532614 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1196221025 X:113112457-113112479 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1196299972 X:114041959-114041981 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1196341756 X:114605036-114605058 TTACAGCCCTAGACCCTAAAAGG - Intronic
1196469872 X:116012630-116012652 TTACAGCCTTAGACCCTGAAGGG + Intergenic
1196496822 X:116332772-116332794 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1196525518 X:116724718-116724740 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1196533578 X:116816198-116816220 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1196572462 X:117281135-117281157 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1196773892 X:119321500-119321522 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1196992726 X:121346745-121346767 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1197064875 X:122224011-122224033 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1197352100 X:125392579-125392601 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1197499683 X:127228544-127228566 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1197793603 X:130279010-130279032 TTATAGCCCTAGACCCTGAAAGG + Intergenic
1197933037 X:131714022-131714044 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1198965881 X:142228496-142228518 TTACAGCCCTAGACCCTGAAAGG + Intergenic
1200532878 Y:4359131-4359153 TTACAGCCCTAGACCCTAAAAGG - Intergenic
1200611182 Y:5328516-5328538 TTACAGCCCTAGACCCTAAAAGG - Intronic
1200659576 Y:5943157-5943179 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1200812810 Y:7502681-7502703 TTACCACCCTAGAGCCAGAGGGG + Intergenic
1201061701 Y:10052054-10052076 TTACTGTCCTAAACCCAGAGGGG - Intergenic
1201234287 Y:11894895-11894917 TTACTGCCCTAGACCCAGAGTGG - Intergenic
1201307543 Y:12563667-12563689 TTACAGCCCTAGACCCTGAAAGG - Intergenic
1201540670 Y:15101990-15102012 TTACAGCCTTGGACCCAGAAGGG - Intergenic
1201581352 Y:15514351-15514373 TTACAGCCCTAGACCCTAAAAGG + Intergenic
1201724853 Y:17140432-17140454 TTACCACCCTAGACCCAGAAGGG - Intergenic
1202062055 Y:20898521-20898543 TTACCACGCTAGACCCAGAGGGG + Intergenic
1202076555 Y:21042855-21042877 ATACCACCCTAGACCCAGAAAGG - Intergenic