ID: 944250996

View in Genome Browser
Species Human (GRCh38)
Location 2:197580091-197580113
Sequence TACCGCCCTAGACCCAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944250989_944250996 5 Left 944250989 2:197580063-197580085 CCCACTTGGCAACAACCCTTAGA No data
Right 944250996 2:197580091-197580113 TACCGCCCTAGACCCAGAGGGGG No data
944250990_944250996 4 Left 944250990 2:197580064-197580086 CCACTTGGCAACAACCCTTAGAT No data
Right 944250996 2:197580091-197580113 TACCGCCCTAGACCCAGAGGGGG No data
944250987_944250996 17 Left 944250987 2:197580051-197580073 CCCAGTTCATGGCCCACTTGGCA No data
Right 944250996 2:197580091-197580113 TACCGCCCTAGACCCAGAGGGGG No data
944250984_944250996 22 Left 944250984 2:197580046-197580068 CCCAGCCCAGTTCATGGCCCACT 0: 8
1: 56
2: 157
3: 266
4: 417
Right 944250996 2:197580091-197580113 TACCGCCCTAGACCCAGAGGGGG No data
944250985_944250996 21 Left 944250985 2:197580047-197580069 CCAGCCCAGTTCATGGCCCACTT 0: 8
1: 55
2: 152
3: 264
4: 435
Right 944250996 2:197580091-197580113 TACCGCCCTAGACCCAGAGGGGG No data
944250991_944250996 -10 Left 944250991 2:197580078-197580100 CCCTTAGATGCTTTACCGCCCTA 0: 13
1: 33
2: 176
3: 343
4: 349
Right 944250996 2:197580091-197580113 TACCGCCCTAGACCCAGAGGGGG No data
944250988_944250996 16 Left 944250988 2:197580052-197580074 CCAGTTCATGGCCCACTTGGCAA No data
Right 944250996 2:197580091-197580113 TACCGCCCTAGACCCAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944250996 Original CRISPR TACCGCCCTAGACCCAGAGG GGG Intronic
No off target data available for this crispr