ID: 944258591

View in Genome Browser
Species Human (GRCh38)
Location 2:197651373-197651395
Sequence ATTTCAATGGCCAGAGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944258585_944258591 -9 Left 944258585 2:197651359-197651381 CCGTAATCCCAGCAATTTCAATG No data
Right 944258591 2:197651373-197651395 ATTTCAATGGCCAGAGCGGGTGG No data
944258583_944258591 11 Left 944258583 2:197651339-197651361 CCAGGCGCAGTGGCTCACGCCCG 0: 68
1: 10092
2: 60302
3: 111861
4: 133068
Right 944258591 2:197651373-197651395 ATTTCAATGGCCAGAGCGGGTGG No data
944258584_944258591 -8 Left 944258584 2:197651358-197651380 CCCGTAATCCCAGCAATTTCAAT No data
Right 944258591 2:197651373-197651395 ATTTCAATGGCCAGAGCGGGTGG No data
944258580_944258591 30 Left 944258580 2:197651320-197651342 CCAAGAAATCATTGTCAGGCCAG No data
Right 944258591 2:197651373-197651395 ATTTCAATGGCCAGAGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944258591 Original CRISPR ATTTCAATGGCCAGAGCGGG TGG Intronic
No off target data available for this crispr