ID: 944259155

View in Genome Browser
Species Human (GRCh38)
Location 2:197657267-197657289
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944259155_944259160 21 Left 944259155 2:197657267-197657289 CCCAAAGGAGACCTGTCTGAAGG No data
Right 944259160 2:197657311-197657333 TTAGTTTGTAACTTCTGCCCTGG No data
944259155_944259161 22 Left 944259155 2:197657267-197657289 CCCAAAGGAGACCTGTCTGAAGG No data
Right 944259161 2:197657312-197657334 TAGTTTGTAACTTCTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944259155 Original CRISPR CCTTCAGACAGGTCTCCTTT GGG (reversed) Intronic