ID: 944260114

View in Genome Browser
Species Human (GRCh38)
Location 2:197667875-197667897
Sequence GCACTGGTGTTAGCAGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944260110_944260114 -4 Left 944260110 2:197667856-197667878 CCCAGTGAGGCACATGTTGGCAC No data
Right 944260114 2:197667875-197667897 GCACTGGTGTTAGCAGGTCCAGG No data
944260107_944260114 9 Left 944260107 2:197667843-197667865 CCTGTCTTTGGGACCCAGTGAGG No data
Right 944260114 2:197667875-197667897 GCACTGGTGTTAGCAGGTCCAGG No data
944260111_944260114 -5 Left 944260111 2:197667857-197667879 CCAGTGAGGCACATGTTGGCACT No data
Right 944260114 2:197667875-197667897 GCACTGGTGTTAGCAGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944260114 Original CRISPR GCACTGGTGTTAGCAGGTCC AGG Intronic
No off target data available for this crispr