ID: 944260713

View in Genome Browser
Species Human (GRCh38)
Location 2:197673217-197673239
Sequence AAGCCTCCTCCCAGCAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944260708_944260713 15 Left 944260708 2:197673179-197673201 CCATGGTGGCCTCTGACAGGCAG No data
Right 944260713 2:197673217-197673239 AAGCCTCCTCCCAGCAACCCAGG No data
944260711_944260713 6 Left 944260711 2:197673188-197673210 CCTCTGACAGGCAGGAGGTGCCA No data
Right 944260713 2:197673217-197673239 AAGCCTCCTCCCAGCAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944260713 Original CRISPR AAGCCTCCTCCCAGCAACCC AGG Intronic
No off target data available for this crispr