ID: 944265384

View in Genome Browser
Species Human (GRCh38)
Location 2:197719092-197719114
Sequence CATAGTTATGTCTACAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944265382_944265384 5 Left 944265382 2:197719064-197719086 CCTGTTGCTACACATATTCTGTA No data
Right 944265384 2:197719092-197719114 CATAGTTATGTCTACAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944265384 Original CRISPR CATAGTTATGTCTACAAATA TGG Intronic
No off target data available for this crispr