ID: 944267129

View in Genome Browser
Species Human (GRCh38)
Location 2:197740766-197740788
Sequence GGGTGCACAGAGTTTCAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944267125_944267129 27 Left 944267125 2:197740716-197740738 CCAGGGACTAGGGGTTGAGAGGA No data
Right 944267129 2:197740766-197740788 GGGTGCACAGAGTTTCAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944267129 Original CRISPR GGGTGCACAGAGTTTCAACT TGG Intronic
No off target data available for this crispr