ID: 944275753

View in Genome Browser
Species Human (GRCh38)
Location 2:197835564-197835586
Sequence TAGGAGCAGCATGATATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944275749_944275753 1 Left 944275749 2:197835540-197835562 CCAAAACTTGATATCCACTATTA No data
Right 944275753 2:197835564-197835586 TAGGAGCAGCATGATATGGTAGG No data
944275748_944275753 16 Left 944275748 2:197835525-197835547 CCATGTTTAATAGTGCCAAAACT No data
Right 944275753 2:197835564-197835586 TAGGAGCAGCATGATATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944275753 Original CRISPR TAGGAGCAGCATGATATGGT AGG Intronic
No off target data available for this crispr