ID: 944276435

View in Genome Browser
Species Human (GRCh38)
Location 2:197843740-197843762
Sequence TCCTTCCCCTTTCAGATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944276435_944276437 -9 Left 944276435 2:197843740-197843762 CCCTAGATCTGAAAGGGGAAGGA No data
Right 944276437 2:197843754-197843776 GGGGAAGGAACAATTTTAGTAGG No data
944276435_944276438 -4 Left 944276435 2:197843740-197843762 CCCTAGATCTGAAAGGGGAAGGA No data
Right 944276438 2:197843759-197843781 AGGAACAATTTTAGTAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944276435 Original CRISPR TCCTTCCCCTTTCAGATCTA GGG (reversed) Intronic
No off target data available for this crispr