ID: 944278688

View in Genome Browser
Species Human (GRCh38)
Location 2:197870042-197870064
Sequence TGGGCGGCCACGAAGCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944278680_944278688 22 Left 944278680 2:197869997-197870019 CCAAACTTTGTGAAACAGGAAGG No data
Right 944278688 2:197870042-197870064 TGGGCGGCCACGAAGCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944278688 Original CRISPR TGGGCGGCCACGAAGCATCA TGG Intronic
No off target data available for this crispr