ID: 944282033

View in Genome Browser
Species Human (GRCh38)
Location 2:197909340-197909362
Sequence CTTCTGTTCCTTAGCAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944282033_944282036 1 Left 944282033 2:197909340-197909362 CCTTTTTTGCTAAGGAACAGAAG No data
Right 944282036 2:197909364-197909386 GGGCACTAAAAATTCGTGCCTGG No data
944282033_944282038 30 Left 944282033 2:197909340-197909362 CCTTTTTTGCTAAGGAACAGAAG No data
Right 944282038 2:197909393-197909415 TAAGACTTGCTCCAACATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944282033 Original CRISPR CTTCTGTTCCTTAGCAAAAA AGG (reversed) Intronic
No off target data available for this crispr