ID: 944284023

View in Genome Browser
Species Human (GRCh38)
Location 2:197927456-197927478
Sequence ATGTTCTTCTATCATTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944284020_944284023 8 Left 944284020 2:197927425-197927447 CCTTTGGGATTTCAAGAAGAATT No data
Right 944284023 2:197927456-197927478 ATGTTCTTCTATCATTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944284023 Original CRISPR ATGTTCTTCTATCATTTTGA GGG Intronic
No off target data available for this crispr