ID: 944293912

View in Genome Browser
Species Human (GRCh38)
Location 2:198040527-198040549
Sequence CCCACCAAGGAGAAGCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944293912_944293920 11 Left 944293912 2:198040527-198040549 CCAAACTGCTTCTCCTTGGTGGG No data
Right 944293920 2:198040561-198040583 TTCTAGAGGAGGATCTGAGGAGG No data
944293912_944293916 -3 Left 944293912 2:198040527-198040549 CCAAACTGCTTCTCCTTGGTGGG No data
Right 944293916 2:198040547-198040569 GGGTGGAATTTCCGTTCTAGAGG No data
944293912_944293921 28 Left 944293912 2:198040527-198040549 CCAAACTGCTTCTCCTTGGTGGG No data
Right 944293921 2:198040578-198040600 AGGAGGCTTATGAGCTTCCCTGG No data
944293912_944293922 29 Left 944293912 2:198040527-198040549 CCAAACTGCTTCTCCTTGGTGGG No data
Right 944293922 2:198040579-198040601 GGAGGCTTATGAGCTTCCCTGGG No data
944293912_944293917 0 Left 944293912 2:198040527-198040549 CCAAACTGCTTCTCCTTGGTGGG No data
Right 944293917 2:198040550-198040572 TGGAATTTCCGTTCTAGAGGAGG No data
944293912_944293919 8 Left 944293912 2:198040527-198040549 CCAAACTGCTTCTCCTTGGTGGG No data
Right 944293919 2:198040558-198040580 CCGTTCTAGAGGAGGATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944293912 Original CRISPR CCCACCAAGGAGAAGCAGTT TGG (reversed) Intronic
No off target data available for this crispr