ID: 944293915

View in Genome Browser
Species Human (GRCh38)
Location 2:198040540-198040562
Sequence AACGGAAATTCCACCCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944293915_944293922 16 Left 944293915 2:198040540-198040562 CCTTGGTGGGTGGAATTTCCGTT No data
Right 944293922 2:198040579-198040601 GGAGGCTTATGAGCTTCCCTGGG No data
944293915_944293919 -5 Left 944293915 2:198040540-198040562 CCTTGGTGGGTGGAATTTCCGTT No data
Right 944293919 2:198040558-198040580 CCGTTCTAGAGGAGGATCTGAGG No data
944293915_944293920 -2 Left 944293915 2:198040540-198040562 CCTTGGTGGGTGGAATTTCCGTT No data
Right 944293920 2:198040561-198040583 TTCTAGAGGAGGATCTGAGGAGG No data
944293915_944293921 15 Left 944293915 2:198040540-198040562 CCTTGGTGGGTGGAATTTCCGTT No data
Right 944293921 2:198040578-198040600 AGGAGGCTTATGAGCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944293915 Original CRISPR AACGGAAATTCCACCCACCA AGG (reversed) Intronic
No off target data available for this crispr