ID: 944293919

View in Genome Browser
Species Human (GRCh38)
Location 2:198040558-198040580
Sequence CCGTTCTAGAGGAGGATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944293912_944293919 8 Left 944293912 2:198040527-198040549 CCAAACTGCTTCTCCTTGGTGGG No data
Right 944293919 2:198040558-198040580 CCGTTCTAGAGGAGGATCTGAGG No data
944293915_944293919 -5 Left 944293915 2:198040540-198040562 CCTTGGTGGGTGGAATTTCCGTT No data
Right 944293919 2:198040558-198040580 CCGTTCTAGAGGAGGATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944293919 Original CRISPR CCGTTCTAGAGGAGGATCTG AGG Intronic
No off target data available for this crispr