ID: 944294625

View in Genome Browser
Species Human (GRCh38)
Location 2:198048541-198048563
Sequence CCAGTCATGCAGAAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944294619_944294625 12 Left 944294619 2:198048506-198048528 CCAGCATCTGCTTCTGGTGAGGC 0: 108
1: 515
2: 832
3: 829
4: 747
Right 944294625 2:198048541-198048563 CCAGTCATGCAGAAGGTGAAGGG No data
944294621_944294625 -10 Left 944294621 2:198048528-198048550 CCTCTGGAAACTTCCAGTCATGC No data
Right 944294625 2:198048541-198048563 CCAGTCATGCAGAAGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944294625 Original CRISPR CCAGTCATGCAGAAGGTGAA GGG Intronic
No off target data available for this crispr