ID: 944304616

View in Genome Browser
Species Human (GRCh38)
Location 2:198165263-198165285
Sequence CGGTGCTAGAGCTATTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944304616_944304624 15 Left 944304616 2:198165263-198165285 CCCACCCAATAGCTCTAGCACCG No data
Right 944304624 2:198165301-198165323 CGTGGTAACTTAAAAGATTATGG No data
944304616_944304625 21 Left 944304616 2:198165263-198165285 CCCACCCAATAGCTCTAGCACCG No data
Right 944304625 2:198165307-198165329 AACTTAAAAGATTATGGCACTGG No data
944304616_944304623 -3 Left 944304616 2:198165263-198165285 CCCACCCAATAGCTCTAGCACCG No data
Right 944304623 2:198165283-198165305 CCGGAATAGTAGGAGAGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944304616 Original CRISPR CGGTGCTAGAGCTATTGGGT GGG (reversed) Intronic
No off target data available for this crispr