ID: 944306467

View in Genome Browser
Species Human (GRCh38)
Location 2:198185431-198185453
Sequence CTGTATACCTAGAAGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944306466_944306467 3 Left 944306466 2:198185405-198185427 CCTAAATAATAAGACTACTTACT No data
Right 944306467 2:198185431-198185453 CTGTATACCTAGAAGTTTGAAGG No data
944306465_944306467 14 Left 944306465 2:198185394-198185416 CCAAAAAGTGGCCTAAATAATAA No data
Right 944306467 2:198185431-198185453 CTGTATACCTAGAAGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944306467 Original CRISPR CTGTATACCTAGAAGTTTGA AGG Intronic
No off target data available for this crispr