ID: 944306906

View in Genome Browser
Species Human (GRCh38)
Location 2:198189099-198189121
Sequence ACTGTAACACACGCCTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944306903_944306906 5 Left 944306903 2:198189071-198189093 CCTGCAGACAGCAAAACTGAAAG 0: 8
1: 15
2: 43
3: 125
4: 440
Right 944306906 2:198189099-198189121 ACTGTAACACACGCCTGCTGGGG No data
944306902_944306906 8 Left 944306902 2:198189068-198189090 CCGCCTGCAGACAGCAAAACTGA No data
Right 944306906 2:198189099-198189121 ACTGTAACACACGCCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944306906 Original CRISPR ACTGTAACACACGCCTGCTG GGG Intronic
No off target data available for this crispr