ID: 944308771

View in Genome Browser
Species Human (GRCh38)
Location 2:198208456-198208478
Sequence GAGTGTTTACAGATGGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944308769_944308771 29 Left 944308769 2:198208404-198208426 CCACTTAGAATCAGAAGAGGTTC No data
Right 944308771 2:198208456-198208478 GAGTGTTTACAGATGGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944308771 Original CRISPR GAGTGTTTACAGATGGTACA TGG Intronic
No off target data available for this crispr