ID: 944309592

View in Genome Browser
Species Human (GRCh38)
Location 2:198218603-198218625
Sequence TTCTAGAGAGATAGCCTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944309591_944309592 -3 Left 944309591 2:198218583-198218605 CCTGGTGAAAGTTAAAAGCTTTC No data
Right 944309592 2:198218603-198218625 TTCTAGAGAGATAGCCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944309592 Original CRISPR TTCTAGAGAGATAGCCTGAT AGG Intronic
No off target data available for this crispr