ID: 944310216

View in Genome Browser
Species Human (GRCh38)
Location 2:198224843-198224865
Sequence TGCCCCCATCCCCCAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944310211_944310216 7 Left 944310211 2:198224813-198224835 CCTAGACTGTCTATTCAAGTTTC No data
Right 944310216 2:198224843-198224865 TGCCCCCATCCCCCAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944310216 Original CRISPR TGCCCCCATCCCCCAGGGGC TGG Intronic
No off target data available for this crispr