ID: 944310276

View in Genome Browser
Species Human (GRCh38)
Location 2:198225399-198225421
Sequence CACTGTCCAAATAACTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944310276_944310277 3 Left 944310276 2:198225399-198225421 CCAGACAAGTTATTTGGACAGTG No data
Right 944310277 2:198225425-198225447 ATTTCATATAGAGAATCATATGG No data
944310276_944310278 15 Left 944310276 2:198225399-198225421 CCAGACAAGTTATTTGGACAGTG No data
Right 944310278 2:198225437-198225459 GAATCATATGGAAAGATAACTGG No data
944310276_944310279 20 Left 944310276 2:198225399-198225421 CCAGACAAGTTATTTGGACAGTG No data
Right 944310279 2:198225442-198225464 ATATGGAAAGATAACTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944310276 Original CRISPR CACTGTCCAAATAACTTGTC TGG (reversed) Intronic
No off target data available for this crispr