ID: 944311137

View in Genome Browser
Species Human (GRCh38)
Location 2:198235173-198235195
Sequence ATGGCTTAGCACCACCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944311137_944311142 19 Left 944311137 2:198235173-198235195 CCAAGAGGGTGGTGCTAAGCCAT No data
Right 944311142 2:198235215-198235237 TGATCCAATCACCTCCCATCTGG 0: 150
1: 2390
2: 4942
3: 7923
4: 10282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944311137 Original CRISPR ATGGCTTAGCACCACCCTCT TGG (reversed) Intronic
No off target data available for this crispr