ID: 944311383

View in Genome Browser
Species Human (GRCh38)
Location 2:198237414-198237436
Sequence GATCATAGTGCACCACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944311381_944311383 10 Left 944311381 2:198237381-198237403 CCAGGCTGGAATGCAGTGGCTAT 0: 75
1: 644
2: 2790
3: 26890
4: 211486
Right 944311383 2:198237414-198237436 GATCATAGTGCACCACAGCCTGG No data
944311380_944311383 11 Left 944311380 2:198237380-198237402 CCCAGGCTGGAATGCAGTGGCTA 0: 84
1: 1275
2: 19176
3: 190899
4: 262580
Right 944311383 2:198237414-198237436 GATCATAGTGCACCACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944311383 Original CRISPR GATCATAGTGCACCACAGCC TGG Intronic
No off target data available for this crispr