ID: 944312904

View in Genome Browser
Species Human (GRCh38)
Location 2:198254577-198254599
Sequence ACTGATATGCTGTCTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944312904_944312907 10 Left 944312904 2:198254577-198254599 CCTGGCACAGACAGCATATCAGT No data
Right 944312907 2:198254610-198254632 GGCAGATAATATGCCAGATAAGG No data
944312904_944312909 29 Left 944312904 2:198254577-198254599 CCTGGCACAGACAGCATATCAGT No data
Right 944312909 2:198254629-198254651 AAGGAAAGTATTCTAATCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944312904 Original CRISPR ACTGATATGCTGTCTGTGCC AGG (reversed) Intronic
No off target data available for this crispr