ID: 944312907

View in Genome Browser
Species Human (GRCh38)
Location 2:198254610-198254632
Sequence GGCAGATAATATGCCAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944312904_944312907 10 Left 944312904 2:198254577-198254599 CCTGGCACAGACAGCATATCAGT No data
Right 944312907 2:198254610-198254632 GGCAGATAATATGCCAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944312907 Original CRISPR GGCAGATAATATGCCAGATA AGG Intronic
No off target data available for this crispr