ID: 944312938

View in Genome Browser
Species Human (GRCh38)
Location 2:198254971-198254993
Sequence GACATACATCCTGTTCGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944312932_944312938 11 Left 944312932 2:198254937-198254959 CCCCTATTTGCACAGTAACCCAA No data
Right 944312938 2:198254971-198254993 GACATACATCCTGTTCGTGCAGG No data
944312935_944312938 -7 Left 944312935 2:198254955-198254977 CCCAATTTTTAGCCTTGACATAC No data
Right 944312938 2:198254971-198254993 GACATACATCCTGTTCGTGCAGG No data
944312936_944312938 -8 Left 944312936 2:198254956-198254978 CCAATTTTTAGCCTTGACATACA No data
Right 944312938 2:198254971-198254993 GACATACATCCTGTTCGTGCAGG No data
944312934_944312938 9 Left 944312934 2:198254939-198254961 CCTATTTGCACAGTAACCCAATT No data
Right 944312938 2:198254971-198254993 GACATACATCCTGTTCGTGCAGG No data
944312933_944312938 10 Left 944312933 2:198254938-198254960 CCCTATTTGCACAGTAACCCAAT No data
Right 944312938 2:198254971-198254993 GACATACATCCTGTTCGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944312938 Original CRISPR GACATACATCCTGTTCGTGC AGG Intronic
No off target data available for this crispr