ID: 944315244

View in Genome Browser
Species Human (GRCh38)
Location 2:198277733-198277755
Sequence CAGGATCTGGAGCAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944315244_944315254 24 Left 944315244 2:198277733-198277755 CCCTCCTCCTGCTCCAGATCCTG No data
Right 944315254 2:198277780-198277802 CAATGTTTGGTCTATTTTGATGG No data
944315244_944315250 -6 Left 944315244 2:198277733-198277755 CCCTCCTCCTGCTCCAGATCCTG No data
Right 944315250 2:198277750-198277772 ATCCTGTGACTGTCCTTGTCGGG No data
944315244_944315253 11 Left 944315244 2:198277733-198277755 CCCTCCTCCTGCTCCAGATCCTG No data
Right 944315253 2:198277767-198277789 GTCGGGAACAATTCAATGTTTGG No data
944315244_944315249 -7 Left 944315244 2:198277733-198277755 CCCTCCTCCTGCTCCAGATCCTG No data
Right 944315249 2:198277749-198277771 GATCCTGTGACTGTCCTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944315244 Original CRISPR CAGGATCTGGAGCAGGAGGA GGG (reversed) Intronic
No off target data available for this crispr