ID: 944315249

View in Genome Browser
Species Human (GRCh38)
Location 2:198277749-198277771
Sequence GATCCTGTGACTGTCCTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944315245_944315249 -8 Left 944315245 2:198277734-198277756 CCTCCTCCTGCTCCAGATCCTGT No data
Right 944315249 2:198277749-198277771 GATCCTGTGACTGTCCTTGTCGG No data
944315244_944315249 -7 Left 944315244 2:198277733-198277755 CCCTCCTCCTGCTCCAGATCCTG No data
Right 944315249 2:198277749-198277771 GATCCTGTGACTGTCCTTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944315249 Original CRISPR GATCCTGTGACTGTCCTTGT CGG Intronic
No off target data available for this crispr