ID: 944315250

View in Genome Browser
Species Human (GRCh38)
Location 2:198277750-198277772
Sequence ATCCTGTGACTGTCCTTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944315246_944315250 -10 Left 944315246 2:198277737-198277759 CCTCCTGCTCCAGATCCTGTGAC No data
Right 944315250 2:198277750-198277772 ATCCTGTGACTGTCCTTGTCGGG No data
944315245_944315250 -7 Left 944315245 2:198277734-198277756 CCTCCTCCTGCTCCAGATCCTGT No data
Right 944315250 2:198277750-198277772 ATCCTGTGACTGTCCTTGTCGGG No data
944315244_944315250 -6 Left 944315244 2:198277733-198277755 CCCTCCTCCTGCTCCAGATCCTG No data
Right 944315250 2:198277750-198277772 ATCCTGTGACTGTCCTTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944315250 Original CRISPR ATCCTGTGACTGTCCTTGTC GGG Intronic
No off target data available for this crispr