ID: 944315254

View in Genome Browser
Species Human (GRCh38)
Location 2:198277780-198277802
Sequence CAATGTTTGGTCTATTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944315247_944315254 17 Left 944315247 2:198277740-198277762 CCTGCTCCAGATCCTGTGACTGT No data
Right 944315254 2:198277780-198277802 CAATGTTTGGTCTATTTTGATGG No data
944315245_944315254 23 Left 944315245 2:198277734-198277756 CCTCCTCCTGCTCCAGATCCTGT No data
Right 944315254 2:198277780-198277802 CAATGTTTGGTCTATTTTGATGG No data
944315246_944315254 20 Left 944315246 2:198277737-198277759 CCTCCTGCTCCAGATCCTGTGAC No data
Right 944315254 2:198277780-198277802 CAATGTTTGGTCTATTTTGATGG No data
944315244_944315254 24 Left 944315244 2:198277733-198277755 CCCTCCTCCTGCTCCAGATCCTG No data
Right 944315254 2:198277780-198277802 CAATGTTTGGTCTATTTTGATGG No data
944315248_944315254 11 Left 944315248 2:198277746-198277768 CCAGATCCTGTGACTGTCCTTGT No data
Right 944315254 2:198277780-198277802 CAATGTTTGGTCTATTTTGATGG No data
944315252_944315254 -6 Left 944315252 2:198277763-198277785 CCTTGTCGGGAACAATTCAATGT No data
Right 944315254 2:198277780-198277802 CAATGTTTGGTCTATTTTGATGG No data
944315251_944315254 5 Left 944315251 2:198277752-198277774 CCTGTGACTGTCCTTGTCGGGAA No data
Right 944315254 2:198277780-198277802 CAATGTTTGGTCTATTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944315254 Original CRISPR CAATGTTTGGTCTATTTTGA TGG Intronic
No off target data available for this crispr