ID: 944315387

View in Genome Browser
Species Human (GRCh38)
Location 2:198279804-198279826
Sequence CAGCTTCCATACCAAGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944315387_944315388 4 Left 944315387 2:198279804-198279826 CCTAGGGCTTGGTATGGAAGCTG No data
Right 944315388 2:198279831-198279853 CACATCTTTACAATATATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944315387 Original CRISPR CAGCTTCCATACCAAGCCCT AGG (reversed) Intronic
No off target data available for this crispr