ID: 944315388

View in Genome Browser
Species Human (GRCh38)
Location 2:198279831-198279853
Sequence CACATCTTTACAATATATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944315387_944315388 4 Left 944315387 2:198279804-198279826 CCTAGGGCTTGGTATGGAAGCTG No data
Right 944315388 2:198279831-198279853 CACATCTTTACAATATATCCAGG No data
944315383_944315388 12 Left 944315383 2:198279796-198279818 CCTCCCTACCTAGGGCTTGGTAT No data
Right 944315388 2:198279831-198279853 CACATCTTTACAATATATCCAGG No data
944315386_944315388 8 Left 944315386 2:198279800-198279822 CCTACCTAGGGCTTGGTATGGAA No data
Right 944315388 2:198279831-198279853 CACATCTTTACAATATATCCAGG No data
944315385_944315388 9 Left 944315385 2:198279799-198279821 CCCTACCTAGGGCTTGGTATGGA No data
Right 944315388 2:198279831-198279853 CACATCTTTACAATATATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944315388 Original CRISPR CACATCTTTACAATATATCC AGG Intronic
No off target data available for this crispr