ID: 944320478

View in Genome Browser
Species Human (GRCh38)
Location 2:198335313-198335335
Sequence GGTTTCTACTTATGCTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944320470_944320478 12 Left 944320470 2:198335278-198335300 CCTGTTTAACAAGCAAAATCCAA No data
Right 944320478 2:198335313-198335335 GGTTTCTACTTATGCTCAGGGGG No data
944320473_944320478 -7 Left 944320473 2:198335297-198335319 CCAAACCATAGGTCTTGGTTTCT No data
Right 944320478 2:198335313-198335335 GGTTTCTACTTATGCTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944320478 Original CRISPR GGTTTCTACTTATGCTCAGG GGG Intronic
No off target data available for this crispr