ID: 944325777

View in Genome Browser
Species Human (GRCh38)
Location 2:198401825-198401847
Sequence CAGATCATGCAGGACCTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944325777_944325779 -7 Left 944325777 2:198401825-198401847 CCTACAAGGTCCTGCATGATCTG No data
Right 944325779 2:198401841-198401863 TGATCTGACCTCACTGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944325777 Original CRISPR CAGATCATGCAGGACCTTGT AGG (reversed) Intronic
No off target data available for this crispr